Python bindings for rnapkin! :snake: :crab:

Rnapkin is a fast, convenient CLI utility for drawing RNAs that produces stylish SVGs. These Python bindings provide an easy way to use rnapkin's functionality directly from your Python scripts.

This is an early implementation that currently only exposes the rna2svg function. It takes an RNA fold in rnapkin compliant format and returns the corresponding SVG as a string.

Installation

pip install rnapykin

Quick Example

from rnapykin import rna2svg

gorgeous_rna = """
    UUAUAGGCGAUGGAGUUCGCCAUAAACGCUGCUUAGCUAAUGACUCCUACCAGUAUCACUACUGGUAGGAGUCUAUUUUUUU
    .....(((((......)))))......(((....)))....((((((((((((((....)))))))))))))).........
    """

# rna / theme / rotation in degrees / background opacity / horizontal flip / vertical flip
svg = rna2svg(gorgeous_rna, "dark", 0, 1., False, False)

# do with it what you want. Save it, embed it in HTML, whatevs c:
with open("gorgeous_rna.svg", "w") as f:
    f.write(svg)