Skip to main content

Deep generalizable prediction of RNA secondary structure via base pair motif energy.

Project description

Deep generalizable prediction of RNA secondary structure via base pair motif energy

Heqin Zhu · Fenghe Tang · Quan Quan · Ke Chen · Peng Xiong* · S. Kevin Zhou*

Submitted

bioRxiv | PDF | GitHub | PyPI

Introduction

overview Deep learning methods have demonstrated great performance for RNA secondary structure prediction. However, generalizability is a common unsolved issue on unseen out-of-distribution RNA families, which hinders further improvement of the accuracy and robustness of deep learning methods. Here we construct a base pair motif library that enumerates the complete space of locally adjacent three-neighbor base pair and records the thermodynamic energy of corresponding base pair motifs through de novo modeling of tertiary structures, and we further develop a deep learning approach for RNA secondary structure prediction, named BPfold, which learns relationship between RNA sequence and the energy map of base pair motif. Experiments on sequence-wise and family-wise datasets have demonstrated the great superiority of BPfold compared to other state-of-the-art approaches in accuracy and generalizability. We hope this work contributes to integrating physical priors and deep learning methods for the further discovery of RNA structures and functionalities.

Installation

Requirements

  • python3.8+
  • anaconda

Instructions

  1. Clone this repo
git clone git@github.com:heqin-zhu/BPfold.git
cd BPfold
  1. Create and activate BPfold environment.
conda env create -f BPfold_environment.yaml
conda activate BPfold
  1. Install BPfold
pip3 install BPfold --index-url https://pypi.org/simple
  1. Download model_predict.tar.gz in releases and decompress it.
wget https://github.com/heqin-zhu/BPfold/releases/latest/download/model_predict.tar.gz
tar -xzf model_predict.tar.gz
  1. Optional: Download datasets BPfold_data.tar.gz in releases and decompress them.
wget https://github.com/heqin-zhu/BPfold/releases/latest/download/BPfold_data.tar.gz
tar -xzf BPfold_data.tar.gz 

Usage

BPfold motif library

The base pair motif library is publicly available in releases, which contains the motif:energy pairs. The motif is represented as sequence_pairIdx_pairIdx-chainBreak where pairIdx is 0-indexed, and the energy is a reference score of statistical and physical thermodynamic energy. For instance, CAAAAUG_0_6-3 -49.7835 represents motif CAAAAUG has a known pair C-G whose indexes are 0 and 6, with chainBreak lying at position 3.

[!NOTE] The base pair motif library can be used as thermodynamic priors in other models.

BPfold Prediction

Use BPfold to predict RNA secondary structures. The following are some examples. The out_type can be csv, bpseq, ct or dbn, which is defaultly set as csv.

BPfold --checkpoint_dir PATH_TO_CHECKPOINT_DIR --seq GGUAAAACAGCCUGU AGUAGGAUGUAUAUG --output BPfold_results
BPfold --checkpoint_dir PATH_TO_CHECKPOINT_DIR --input examples/examples.fasta --out_type csv # (multiple sequences are supported)
BPfold --checkpoint_dir PATH_TO_CHECKPOINT_DIR --input examples/URS0000D6831E_12908_1-117.bpseq # .bpseq, .ct, .dbn
Example of BPfold prediction

Here are the outputs after running BPfold --checkpoint_dir model_predict --input examples/examples.fasta --out_type bpseq:

>> Welcome to use "BPfold" for predicting RNA secondary structure!
Loading paras/model_predict/BPfold_1-6.pth
Loading paras/model_predict/BPfold_2-6.pth
Loading paras/model_predict/BPfold_3-6.pth
Loading paras/model_predict/BPfold_4-6.pth
Loading paras/model_predict/BPfold_5-6.pth
Loading paras/model_predict/BPfold_6-6.pth
[    1] saved in "BPfold_results/SS/5s_Shigella-flexneri-3.bpseq", CI=0.980
CUGGCGGCAGUUGCGCGGUGGUCCCACCUGACCCCAUGCCGAACUCAGAAGUGAAACGCCGUAGCGCCGAUGGUAGUGUGGGGUCUCCCCAUGCGAGAGUAGGGAACUGCCAG
(((((((.....((((((((.....((((((.............))))..))....)))))).)).((.((....((((((((...))))))))....)).))...)))))))
[    2] saved in "BPfold_results/SS/URS0000D6831E_12908_1-117.bpseq", CI=0.931
UUAUCUCAUCAUGAGCGGUUUCUCUCACAAACCCGCCAACCGAGCCUAAAAGCCACGGUGGUCAGUUCCGCUAAAAGGAAUGAUGUGCCUUUUAUUAGGAAAAAGUGGAACCGCCUG
......((((((..(.(((((.......))))))(((.((((.((......))..))))))).................))))))..(((......)))..................
Finished!

For more help information, please run command BPfold -h to see.

Reproduction

For reproduction of all the quantitative results, we provide the predicted secondary structures and model parameters of BPfold in experiments. You can directly downalod the predicted secondary structures by BPfold or use BPfold with trained parameters to predict these secondary structures, and then evaluate the predicted results.

Directly download

wget https://github.com/heqin-zhu/BPfold/releases/latest/download/BPfold_test_results.tar.gz
tar -xzf BPfold_test_results.tar.gz

Use BPfold

  1. Download BPfold_reproduce.tar.gz in releases.
wget https://github.com/heqin-zhu/BPfold/releases/latest/download/model_reproduce.tar.gz
tar -xzf model_reproduce.tar.gz
  1. Use BPfold to predict test sequences.

Evaluate

BPfold_eval --gt_dir BPfold_data --pred_dir BPfold_test_results

After running above commands for evaluation, you will see the following outputs:

Outputs of evaluating BPfold
Time used: 29s
[Summary] eval_BPfold_test_results.yaml
 Pred/Total num: [('PDB_test', 116, 116), ('Rfam12.3-14.10', 10791, 10791), ('archiveII', 3966, 3966), ('bpRNA', 1305, 1305), ('bpRNAnew', 5401, 5401)]
-------------------------len>600-------------------------
dataset         & num   & INF   & F1    & P     & R    \\
Rfam12.3-14.10  & 64    & 0.395 & 0.387 & 0.471 & 0.333\\
archiveII       & 55    & 0.352 & 0.311 & 0.580 & 0.242\\
------------------------len<=600-------------------------
dataset         & num   & INF   & F1    & P     & R    \\
PDB_test        & 116   & 0.817 & 0.814 & 0.840 & 0.801\\
Rfam12.3-14.10  & 10727 & 0.696 & 0.690 & 0.662 & 0.743\\
archiveII       & 3911  & 0.829 & 0.827 & 0.821 & 0.843\\
bpRNA           & 1305  & 0.670 & 0.658 & 0.599 & 0.770\\
bpRNAnew        & 5401  & 0.655 & 0.647 & 0.604 & 0.723\\
---------------------------all---------------------------
dataset         & num   & INF   & F1    & P     & R    \\
PDB_test        & 116   & 0.817 & 0.814 & 0.840 & 0.801\\
Rfam12.3-14.10  & 10791 & 0.694 & 0.689 & 0.660 & 0.741\\
archiveII       & 3966  & 0.823 & 0.820 & 0.818 & 0.834\\
bpRNA           & 1305  & 0.670 & 0.658 & 0.599 & 0.770\\
bpRNAnew        & 5401  & 0.655 & 0.647 & 0.604 & 0.723\\

Acknowledgement

We appreciate the following open source projects:

LICENSE

MIT LICENSE

Citation

If you use our code, please kindly consider to cite our paper:

@article {Zhu2024.10.22.619430,
    author = {Zhu, Heqin and Tang, Fenghe and Quan, Quan and Chen, Ke and Xiong, Peng and Zhou, S. Kevin},
    title = {Deep generalizable prediction of RNA secondary structure via base pair motif energy},
    elocation-id = {2024.10.22.619430},
    year = {2024},
    doi = {10.1101/2024.10.22.619430},
    publisher = {Cold Spring Harbor Laboratory},
    URL = {https://www.biorxiv.org/content/early/2024/10/25/2024.10.22.619430},
    eprint = {https://www.biorxiv.org/content/early/2024/10/25/2024.10.22.619430.full.pdf},
    journal = {bioRxiv}
}

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

bpfold-0.2.5.tar.gz (431.3 kB view details)

Uploaded Source

Built Distribution

If you're not sure about the file name format, learn more about wheel file names.

bpfold-0.2.5-py3-none-any.whl (440.2 kB view details)

Uploaded Python 3

File details

Details for the file bpfold-0.2.5.tar.gz.

File metadata

  • Download URL: bpfold-0.2.5.tar.gz
  • Upload date:
  • Size: 431.3 kB
  • Tags: Source
  • Uploaded using Trusted Publishing? Yes
  • Uploaded via: twine/6.1.0 CPython/3.12.9

File hashes

Hashes for bpfold-0.2.5.tar.gz
Algorithm Hash digest
SHA256 ddd550db59baefecf175a2578e51c83b3afc09370abfa87cc80e3d1d59976d9c
MD5 1b9ba2f9c14575bc2f2be5829e5bf0a0
BLAKE2b-256 a33f969e68daed431c36e092222a5062fdade6af96291384e4de005b3b7fc531

See more details on using hashes here.

Provenance

The following attestation bundles were made for bpfold-0.2.5.tar.gz:

Publisher: publish.yml on heqin-zhu/BPfold

Attestations: Values shown here reflect the state when the release was signed and may no longer be current.

File details

Details for the file bpfold-0.2.5-py3-none-any.whl.

File metadata

  • Download URL: bpfold-0.2.5-py3-none-any.whl
  • Upload date:
  • Size: 440.2 kB
  • Tags: Python 3
  • Uploaded using Trusted Publishing? Yes
  • Uploaded via: twine/6.1.0 CPython/3.12.9

File hashes

Hashes for bpfold-0.2.5-py3-none-any.whl
Algorithm Hash digest
SHA256 7fbb94c3bd3016b2da6a0c56ada869906abb5483d4c69082430fcb22123d753f
MD5 f0bc8df6d5a93c0c5edaf20c36061d68
BLAKE2b-256 c9023896769050007e97d1c572d454033ec1e1a64dcc67ad17ef313dfdf03407

See more details on using hashes here.

Provenance

The following attestation bundles were made for bpfold-0.2.5-py3-none-any.whl:

Publisher: publish.yml on heqin-zhu/BPfold

Attestations: Values shown here reflect the state when the release was signed and may no longer be current.

Supported by

AWS Cloud computing and Security Sponsor Datadog Monitoring Depot Continuous Integration Fastly CDN Google Download Analytics Pingdom Monitoring Sentry Error logging StatusPage Status page