KOnezumi-AID is the command-line tool to automate the gRNA design for multiplex KO mouse using Target-AID
Installation
Prerequisits
- Python 3.9 or later
- Unix-like environment (Linux, macOS, WSL2, etc.)
Installation🔨
From Bioconda (Recommended)
conda install -c conda-forge -c bioconda konezumiaid
From PyPI:
pip install KOnezumiAID
Required Packages (Not needed if installed via Bioconda)
-
bedtools
Follow the official instruction -
bowtie
Follow the official instruction
Input data set (e.g. Mus musculus mm39)
Locus information
refFlat.txt.gz from UCSC
genomic sequence
mm39.fa.gz from UCSC
Download scripts (bash)
mkdir -p data
curl https://hgdownload.soe.ucsc.edu/goldenPath/mm39/database/refFlat.txt.gz |
gzip -dc > data/refFlat.txt
curl https://hgdownload.soe.ucsc.edu/goldenPath/mm39/bigZips/mm39.fa.gz |
gzip -dc > data/mm39.fa
Usage
KOnezumi-AID's output
- gRNAs to generate PTC (premature termination codon)
- gRNAs to disrupt splice acceptor site
- gRNAs to disrupt splice donor site
KOnezumi-AID provides these gRNAs in standerd output and CSV format.
The CSV file is located in data/output directory and named as
<gene symbol|transcript name>_ptc_gRNA.csv
or
<gene symbol|transcript name>_splice_gRNA.csv.
Create data set for KOnezumi-AID
konezumiaid preprocess <your refFlat.txt Path> <your mm39.fa Path>
Example
konezumiaid preprocess data/refFlat.txt data/mm39.fa
Search candidate by gene symbol or transcript name (Refseq ID)
KOnezumi-AID accepts a gene symbol or a transcript name.
konezumiaid <-n|--name> <gene symbol|ranscript name>
Search by gene symbol
You can obtain the gRNAs that are present in all transcript variants.
[!NOTE]
If the gene has one transcript, the result is the same as searching by the transcript name
Search by transcript name
You can obtain the transcript's gRNAs and access more information about the gRNAs.
- Recommended: whether the gRNA is recommended or not.
- Target amino acid: the amino acid that the gRNA targets.
- Exon index: the index of the exon where the gRNA is located.
[!NOTE] KOnezumi-AID ignores the minor version of the RefSeq ID (e.g., NM_111111.2 → NM_111111) because the refFlat file does not support version numbers.
Batch processing
KOnezumi-AID can process multiple search queries at once using the batch command.
For this purpose, a CSV or Excel file containing gene symbols or transcript names is required.
konezumiaid batch <-f|--file> <gene symbols or transcripts list CSV or Excel file>
[!NOTE] The CSV or Excel file must follow the format below.
- The file should consist of a single column.
- No header row is required. Data should start from the first row.
- Each row should contain only one gene or transcript.
e.g. CSV file
Xkr4 Rp1 Sox17e.g. Excel file
Xkr4 Rp1 Sox17
Examples
Search candidate by the gene symbol (gene symbol with multiple transcripts)
$konezumiaid -n Rp1
Processing NM_001370921...
Processing NM_001195662...
Processing NM_011283...
List of gRNAs to generate PTC (premature termination codon)
Target sequence (20mer + PAM) Target amino acid link to CRISPRdirect
0 ACAGTTTGGCGGCGTTCGGGTGG Q https://crispr.dbcls.jp/?userseq=ACAGTTTGGCGGCGTTCGGGTGG&pam=NGG&db=mm39
1 ACGACACAGCATCACCAGGCTGG R https://crispr.dbcls.jp/?userseq=ACGACACAGCATCACCAGGCTGG&pam=NGG&db=mm39
2 ACAGGTTATGCAGTGTCCTGTGG Q https://crispr.dbcls.jp/?userseq=ACAGGTTATGCAGTGTCCTGTGG&pam=NGG&db=mm39
3 CCAGGGCCGAGGGCGCCTGCGGG W https://crispr.dbcls.jp/?userseq=CCAGGGCCGAGGGCGCCTGCGGG&pam=NGG&db=mm39
4 GCCAGGGCCGAGGGCGCCTGCGG W https://crispr.dbcls.jp/?userseq=GCCAGGGCCGAGGGCGCCTGCGG&pam=NGG&db=mm39
List of gRNAs to disrupt splice acceptor site
No gRNA found.
List of gRNAs to disrupt splice donor site
No gRNA found.
Search candidate by the gene symbol (gene symbol with single transcript)
$konezumiaid -n Mafa
List of gRNAs to generate PTC (premature termination codon)
Target sequence (20mer + PAM) Recommended Target amino acid link to CRISPRdirect
0 CTCAGGCCGGGGGCGCCCCGGGG True 87Q https://crispr.dbcls.jp/?userseq=CTCAGGCCGGGGGCGCCCCGGGG&pam=NGG&db=mm39
1 GCTCAGGCCGGGGGCGCCCCGGG True 87Q https://crispr.dbcls.jp/?userseq=GCTCAGGCCGGGGGCGCCCCGGG&pam=NGG&db=mm39
2 CCAGCACCACCTGAACCCCGAGG True 121Q https://crispr.dbcls.jp/?userseq=CCAGCACCACCTGAACCCCGAGG&pam=NGG&db=mm39
3 GGTCAGAGCTTCGCGGGCGGCGG True 167Q https://crispr.dbcls.jp/?userseq=GGTCAGAGCTTCGCGGGCGGCGG&pam=NGG&db=mm39
List of gRNAs to disrupt splice acceptor site
No gRNA found.
List of gRNAs to disrupt splice donor site
No gRNA found.
Search candidate by the transcript name
$ konezumiaid -n NM_001370921
List of gRNAs to generate PTC (premature termination codon)
Target sequence (20mer + PAM) Recommended Target amino acid link to CRISPRdirect
0 ACAGTTTGGCGGCGTTCGGGTGG False 46Q https://crispr.dbcls.jp/?userseq=ACAGTTTGGCGGCGTTCGGGTGG&pam=NGG&db=mm39
1 ACGACACAGCATCACCAGGCTGG True 88R https://crispr.dbcls.jp/?userseq=ACGACACAGCATCACCAGGCTGG&pam=NGG&db=mm39
2 ACAGGTTATGCAGTGTCCTGTGG True 192Q https://crispr.dbcls.jp/?userseq=ACAGGTTATGCAGTGTCCTGTGG&pam=NGG&db=mm39
3 ACAACCTGTCCTTCCAGGTAAGG True 389Q https://crispr.dbcls.jp/?userseq=ACAACCTGTCCTTCCAGGTAAGG&pam=NGG&db=mm39
4 ACCAATCAGAACAATCCCACTGG True 698Q https://crispr.dbcls.jp/?userseq=ACCAATCAGAACAATCCCACTGG&pam=NGG&db=mm39
5 ACGAATGTATCTGAGGATTAAGG True 723R https://crispr.dbcls.jp/?userseq=ACGAATGTATCTGAGGATTAAGG&pam=NGG&db=mm39
6 TCAGGCCAATGTCACATTGTGGG True 861Q https://crispr.dbcls.jp/?userseq=TCAGGCCAATGTCACATTGTGGG&pam=NGG&db=mm39
7 CTCAGGCCAATGTCACATTGTGG True 861Q https://crispr.dbcls.jp/?userseq=CTCAGGCCAATGTCACATTGTGG&pam=NGG&db=mm39
8 CCAGGGCCGAGGGCGCCTGCGGG True 126W https://crispr.dbcls.jp/?userseq=CCAGGGCCGAGGGCGCCTGCGGG&pam=NGG&db=mm39
9 GCCAGGGCCGAGGGCGCCTGCGG True 126W https://crispr.dbcls.jp/?userseq=GCCAGGGCCGAGGGCGCCTGCGG&pam=NGG&db=mm39
10 TCCAGTGGGATTGTTCTGATTGG True 704W https://crispr.dbcls.jp/?userseq=TCCAGTGGGATTGTTCTGATTGG&pam=NGG&db=mm39
11 CCAGTACTGGGATTTGTCACTGG True 1052W https://crispr.dbcls.jp/?userseq=CCAGTACTGGGATTTGTCACTGG&pam=NGG&db=mm39
List of gRNAs to disrupt splice acceptor site
Target sequence (20mer + PAM) Exon index link to CRISPRdirect
0 ACCTGGGATTGAAAGGAACAAGG 20 https://crispr.dbcls.jp/?userseq=ACCTGGGATTGAAAGGAACAAGG&pam=NGG&db=mm39
1 TCTGTTGGAGAAAAGCCCCATGG 22 https://crispr.dbcls.jp/?userseq=TCTGTTGGAGAAAAGCCCCATGG&pam=NGG&db=mm39
2 ACCTGAAGAAAATGGAAAACAGG 23 https://crispr.dbcls.jp/?userseq=ACCTGAAGAAAATGGAAAACAGG&pam=NGG&db=mm39
List of gRNAs to disrupt splice donor site
Target sequence (20mer + PAM) Exon index link to CRISPRdirect
0 TACCTTGCCCAAGTCCATCATGG 8 https://crispr.dbcls.jp/?userseq=TACCTTGCCCAAGTCCATCATGG&pam=NGG&db=mm39
1 TTACCTCTCACAGGTGAAGATGG 22 https://crispr.dbcls.jp/?userseq=TTACCTCTCACAGGTGAAGATGG&pam=NGG&db=mm39
Version check
$ konezumiaid <-v|--version>
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
Built Distribution
Filter files by name, interpreter, ABI, and platform.
If you're not sure about the file name format, learn more about wheel file names.
Copy a direct link to the current filters
File details
Details for the file konezumiaid-0.3.6.1.tar.gz.
File metadata
- Download URL: konezumiaid-0.3.6.1.tar.gz
- Upload date:
- Size: 22.9 kB
- Tags: Source
- Uploaded using Trusted Publishing? No
- Uploaded via:
twine/6.0.1 CPython/3.12.8
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
fb9c904e43f604b5c40042abff1555c20b99e700c295ca1a03d50875bee2164f
|
|
| MD5 |
315bf23e4a9537e47425191ccdd4738f
|
|
| BLAKE2b-256 |
c91030493af1e4740bb0c4e3a321e2cf1bb01a3f5c322913059fd5207d8f6dfb
|
File details
Details for the file konezumiaid-0.3.6.1-py3-none-any.whl.
File metadata
- Download URL: konezumiaid-0.3.6.1-py3-none-any.whl
- Upload date:
- Size: 31.2 kB
- Tags: Python 3
- Uploaded using Trusted Publishing? No
- Uploaded via:
twine/6.0.1 CPython/3.12.8
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
ae71c89c40b85ace6c15632dcec354b3dbb18b733feb82835e1b404fe50cd0f7
|
|
| MD5 |
a3a343259e68f7fb11fde59c6d286ec2
|
|
| BLAKE2b-256 |
58b7d5f60f9d8df4c0e43968a9eab590327abcf573f4eb2443ed4e3179eeaa34
|