Skip to main content

In silico PCR tool

Project description

README

In-Silico PCR tool

DOI

This script takes a text file with primer sequence (one per line,optinal name in column 2, tab-seperated) and a reference FASTA file as input and identifies primer pairs which amplify a DNA sequence of length less than or equal to a user-specified maximum, at a given Tm and salt concentration. The script outputs the sequences of the primers, the portion of the primer that binds, the number of mismatches, as well as the start and end coordinates of the amplified sequence. It also outputs the Tm of the amplicons and the Tm of amplicon pairs.

Dependencies

These may be installed by running

pip install PCRinSilico

Usage

PCRinSilico [options]
   --primer_seq [path to primer sequence file, one primer per line]
   --ref_fasta_file [path to reference FASTA file]

Options

Argument Description Default
--annealing_temp Annealing temperature (in Celsius). 60.0
--salt_concentration Salt concentration (in nM, Ignored if Q5 True). 50
--max_amplicon_len Maximum length of PCR products in nucleotides. 2000
--req_five Require the 5' end of the primer to bind? True
--out_file Output file name. "in_silico_PCR"
--Q5 Use Q5 approximation settings for Tm calculations? "True"

Example

PCRinSilico \
   --primer_seq ./example/primers.txt \
   --ref_fasta_file  ./example/ref.fasta

in_silico_PCR.tsv

qseq1 qseq2_input qstart1 qend1 direction1 mismatch2 qseq2 qseq1_input qstart2 qend2 direction2 mismatch1 binding_pos_diff reference ref_region
kkd_F_2 gaacaccggcagtggttc 1 18 + 0 sge_R ctgccgcagcggt 1 13 - 0 300 example 772, 1072
kkd_R accgagctgccggacggcac 1 20 + 0 sge_R ctgccgcagcggt 1 13 - 0 318 example 772, 1090

in_silico_PCR_amplicon_interactions.tsv

amplicon1_PF amplicon1_PR amplicon2_PF amplicon2_PR tm
kkd_F_2 sge_R kkd_R sge_R 90.22726832

in_silico_PCR_primer_dimears.tsv

Sequence1 Sequence2 MeltingTemp
sge_F sge_R 75
sge_F kkd_F 72
sge_F kkd_F_2 73
sge_F kkd_R 79
sge_R kkd_F 74
sge_R kkd_F_2 74
sge_R kkd_R 80
kkd_F kkd_F_2 72
kkd_F kkd_R 78
kkd_F_2 kkd_R 78

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

PCRinSilico-1.1.3.tar.gz (6.2 kB view details)

Uploaded Source

Built Distribution

If you're not sure about the file name format, learn more about wheel file names.

PCRinSilico-1.1.3-py3-none-any.whl (6.4 kB view details)

Uploaded Python 3

File details

Details for the file PCRinSilico-1.1.3.tar.gz.

File metadata

  • Download URL: PCRinSilico-1.1.3.tar.gz
  • Upload date:
  • Size: 6.2 kB
  • Tags: Source
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/4.0.2 CPython/3.9.12

File hashes

Hashes for PCRinSilico-1.1.3.tar.gz
Algorithm Hash digest
SHA256 7494cd3a9bdc1515cfc83c6e85be578a670d39ba35c7bd786118607f8e103b78
MD5 f0d46eac86aaf3d99b65e0d475a464c8
BLAKE2b-256 4c8adfcf1b0f4afb23d64db00f8c5277eda4c804aecbcd317bf2c6597acf7d17

See more details on using hashes here.

File details

Details for the file PCRinSilico-1.1.3-py3-none-any.whl.

File metadata

  • Download URL: PCRinSilico-1.1.3-py3-none-any.whl
  • Upload date:
  • Size: 6.4 kB
  • Tags: Python 3
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/4.0.2 CPython/3.9.12

File hashes

Hashes for PCRinSilico-1.1.3-py3-none-any.whl
Algorithm Hash digest
SHA256 8ff0b375f5d02e555ef981b8a08d91226d30aff21e0ac1e1bcb910874c11f113
MD5 41909b06e174c94cda90cee58267c5ca
BLAKE2b-256 eff704395bc7102bc26a188bbf6daaebc291a66b066323d96ace8a9f3c592503

See more details on using hashes here.

Supported by

AWS Cloud computing and Security Sponsor Datadog Monitoring Depot Continuous Integration Fastly CDN Google Download Analytics Pingdom Monitoring Sentry Error logging StatusPage Status page