Skip to main content

Block Resolution and Annotation of Integrated DNA

Project description

BRAID

Block Resolution and Annotation of Integrated DNA

Python Version License Status

Analyze phased VCF data to predict variant effects on protein sequences for each haplotype.

Overview

BRAID is a bioinformatics tool designed to go beyond isolated mutations annotation. By utilizing phased VCF data, this tool reconstructs the combination of mutations present on each chromosome (haplotype) to predict the actual protein sequence produced.

This allows for the detection of complex effects, such as:

  • Compound Heterozygosity: Understanding how multiple mutations on the same haplotype interact.
  • Haplotype-specific LOF: Determining if a combination effect of mutations leads to a Loss of Function.
  • Protein Structure Changes: Visualizing the exact amino acid sequence changes.
Image

Installation & Requirements

BRAID is a software that requires standard bioinformatics libraries.

Prerequisites:

  • Python >= 3.8
  • pysam
  • biopython

installation

Dowload via pip

pip install pybraid

Dowload via conda

conda install braid

Dowload via wget

wget https://github.com/YuefanHuang1998/BRAID/archive/refs/tags/braid-v1.0.1.tar.gz
tar -zxvf braid-v1.0.1
cd BRAID-1.0.1/
pip install .

Dowload via git

git clone https://github.com/YuefanHuang1998/BRAID.git
cd BRAID
pip install .

To verify the installation was successful, run:

braid test

Usage

Run the script from the command line by providing the GFF3 annotation, Reference Genome, and Phased VCF.

braid -r reference.fa -g annotation.gff3 -v phased_variants.vcf.gz

Example for test dataset

braid -r test.fasta -g test.gff3 -v test.vcf.gz

You should have three output files and one log file:
variant_analysis_output.tsv
variant_analysis_output.alignment.txt
variant_analysis_output.sample.txt
variant_analysis_output.log

Arguments Parameter Table

Short Long Description
-g --gff Path to the GFF3 annotation file. Required
-r --reference Path to the Reference Genome FASTA (must be indexed: .fai). Required
-v --vcf Path to the Phased VCF file (must be indexed: .tbi/.csi). Required
-o --output Output file name (default: variant_analysis_output.tsv). Optional
-s --sample Path to file containing specific sample IDs to analyze (one per line, no header). Optional
--gene Path to file with specific gene IDs to analyze (one per line, no header). Optional
--lof-threshold Custom threshold for Loss-of-Function classification (e.g., 0.1; default: 0.3). Optional
--force-unphased Skip phasing check (forces run on unphased VCF). Optional
--ignore-intron Ignore variants marked strictly as intronic. Optional

Output Files Explaination

BRAID generates three main files to assist in your analysis.

1. Summary Table

A comprehensive table detailing the protein changes for every haplotype (default: variant_analysis_output.tsv).

Example View:

Gene_ID Haplotype_ID mRNA Haplotype_Count Frequency Variant_Type Protein_Changes Haplotype_Mutations Sample_Sources Ref_Protein Alt_Protein Ref_CDS Alt_CDS Aligned_Ref Comparison_String Aligned_Alt
gene1 transcript1:REF transcript1 . . NoLOF(non_identity_rate:0.00%,non_identical_AAs:0,total_ref_AAs:27) ||||||||||||||||| . . . MSLASSANDMIDRSIDRSIDRSIDRS* MSLASSANDMIDRSIDRSIDRSIDRS* ATGAGCTTAGCTAGCTCAGCTAACGATATGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGTGA ATGAGCTTAGCTAGCTCAGCTAACGATATGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGTGA MSLASSANDMIDRSIDRSIDRSIDRS* ||||||||||||||||||||||||||| MSLASSANDMIDRSIDRSIDRSIDRS*
gene1 transcript1:1 transcript1 4 0.500000 NoLOF(non_identity_rate:3.70%,non_identical_AAs:1,total_ref_AAs:27)|||deletion |||||||||||||| Del(5)S 1:17_CTTAG>C[CDS,EXON];1:27_T>TT[CDS,EXON] sample1(Hap2);sample2(Hap1);sample3(Homo) MSLASSANDMIDRSIDRSIDRSIDRS* MSLASANDMIDRSIDRSIDRSIDRS* ATGAGCTTAGCTAGCTCAGCTAACGATATGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGTGA ATGAGCCTAGCTTCAGCTAACGATATGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGTGA MSLASSANDMIDRSIDRSIDRSIDRS* |||| |||||||||||||||||||||| MSLA-SANDMIDRSIDRSIDRSIDRS*

Explanation for each column

Column Example Explanation
Gene_ID gene1 The gene to which this haplotype belongs.
Haplotype_ID transcript1:REF;transcript1:1 transcript:REF indicates the reference haplotype; others (e.g. transcript1:1) are alternative haplotypes.
mRNA transcript1 The transcript to which this haplotype belongs.
Haplotype_Count 4 Number of samples carrying this haplotype.
Frequency 0.500000 Population frequency of this haplotype.
Variant_Type LOF/NoLoF (Please see
the detailed information below.)
Functional classification of the haplotype and indicates LOF status.
Protein_Changes Del(5)S Protein-level consequence HGVS format description.
Haplotype_Mutations 1:17_CTTAG>C[CDS,EXON];
1:27_T>TT[CDS,EXON]
List of variants defining the haplotype.
Sample_Sources sample1(Hap2);sample2(Hap1);
sample3(Homo)
Samples carrying this haplotype, including haplotype phase (Hap1, Hap2) or homozygous status (Homo).
Ref_Protein MSLASSANDIDRSIDRS* Reference protein sequence.
Alt_Protein MSLASANDIDRSIDRS* Alternative protein sequence.
Ref_CDS ATGAGCTTAGCTAGCTCAGCTAACGATATCG
ATCGATCGATCGATCGATCGTGA
Reference CDS sequence.
Alt_CDS ATGAGCCTAGCTTCAGCTAACGATATCG
ATCGATCGATCGATCGATCGTGA
Haplotype-specific CDS sequence.
Aligned_Ref MSLASSANDIDRSIDRS* Aligned reference protein, protein alignment string for visualization: - → Gap (insertion or deletion).
Comparison_String MSLASANDIDRSIDRS* Alignment comparison symbols: * → Different amino acid, | → Same amino acid.
Aligned_Alt MSLASANDIDRSIDRS* Aligned alternative protein, shows amino acid changes: - → Gap (insertion or deletion).

Detail information for Variant_Type

Column Explanation
LOF_Info LOF indicates haplotypes predicted to cause protein loss of function, whereas NoLOF indicates haplotypes without LOF effects. non_identity_rate represents the proportion of amino acid differences between ALT and REF proteins; non_identical_AAs is the corresponding count, and total_ref_AAs denotes the length of the REF protein. e.g., NoLOF(non_identity_rate:5.56%,non_identical_AAs:1,total_ref_AAs:18).
missense A nucleotide variant that results in the substitution of one amino acid by another in the protein sequence.
insertion An insertion of one or more nucleotides that alters the coding sequence and may affect the resulting protein sequence.
deletion A deletion of one or more nucleotides from the coding sequence, potentially altering the protein sequence or reading frame.
complex_indel A combined insertion and deletion event that cannot be represented as a simple insertion or deletion and may cause complex changes to the coding sequence.
exon_skip A splicing event in which one or more exons are completely skipped in the transcript, leading to an altered mRNA and protein sequence.
skipped_exons_detail Detailed information specifying which exon is skipped in the exon-skipping event, SITE_PRESERVED, SITE_SHIFT, SITE_DESTROYED. e.g., SkippedExon:[1:51-77|SITE_SHIFT].
intron_retention A splicing event in which one or more introns are retained in the mature transcript, potentially disrupting the coding sequence.
retained_introns_detail Detailed information specifying which intron(s) are retained in the intron-retention event, SITE_PRESERVED, SITE_SHIFT, SITE_DESTROYED. e.g., RetainedIntron:[1:78-90|SITE_DESTROYED].
start_codon_loss A variant that disrupts the canonical start codon, potentially preventing translation initiation.
stop_loss A variant that removes or alters the stop codon, resulting in translational read-through and an extended protein.
No_start_codon_for_reference The reference transcript or protein sequence lacks an annotated start codon.
same_as_other_transcript The variant effect on this protein is identical to that observed in another transcript's protein of the same gene.
protein_loss The variant or variant combination results in the complete loss of the predicted protein product.
ref_protein_empty The reference transcript does not produce a protein sequence (e.g., non-coding or incomplete annotation).
alignment_failed The reference and alternative protein sequences could not be reliably aligned, preventing accurate variant effect annotation.

Log information for splice sites mutations

SITE_PRESERVED: The splice site is unaltered, with both its position and sequence conserved; normal splicing is expected.

[transcript1] (strand +) Splice site 'GT' at 39 PRESERVED by mutation 1:39_GTCG>G.
  - Original Window Seq  : GATGTCGTTAAG     - Mutated Window Seq  : GATGTTAAG.

SITE_SHIFT: The splice site may move to a nearby position due to the variant, potentially altering the exon–intron boundary.

WARNING - [transcript1] Splice site may SHIFT for mutation 1:44_TAAGTA>A.
  - Splice Site          : 'AG' (Original genomic pos: 49)
  - Mutation             : TAAGTA -> A (Genomic pos: 44)
  - Window               : 1:42-53
  - Original Window Seq  : GTTAAGTAGATG
  - Mutated Window Seq   : GTAGATG

SITE_DESTROYED: The splice site is disrupted or abolished by the variant, likely preventing normal splicing at this site.

[transcript1] (strand +) Splice site 'GT' at 78 DESTROYED by mutation 1:50_GATGATCGATCGATCGATCGATCGATCGG>GG. It was 'GT', became 'AT'.
  - Original Window Seq  : TCGGTCGATCGA     - Mutated Window Seq  : TCGATCGA

2. Alignment Visualization (.alignment.txt)

A text file showing the pairwise alignment of the Reference vs. Alternative protein. Use the Haplotype_ID to match the haplotype in the summary table.

Example View:

Haplotype_ID: transcript1:1
Gene: gene1 | mRNA: transcript1
Haplotype_Mutations: 1:17_CTTAG>C[CDS,EXON];1:27_T>TT[CDS,EXON]
Variant_Type: NoLOF(non_identity_rate:3.70%,non_identical_AAs:1,total_ref_AAs:27)|||deletion||||||||||||||
Protein_Changes: Del(5)S
Alignment:
  Ref: MSLASSANDMIDRSIDRSIDRSIDRS*
       |||| ||||||||||||||||||||||
  Alt: MSLA-SANDMIDRSIDRSIDRSIDRS*

3. Sample Matrix (.sample.txt)

A matrix format ideal for heatmaps or downstream programmatic analysis.

Example View:

Gene_ID mRNA_ID Ref_ID Alt_IDs sample1 sample2 sample3
gene1 transcript1 transcript1:REF transcript1:1 0|1 1|0 1|1
Gene_ID  mRNA_ID      Ref_ID           Alt_IDs         sample1 sample2 sample3
gene1    transcript1  transcript1:REF  transcript1:1	  0|1	    1|0     1|1
Column Explanation
Gene_ID The identifier of the gene being analyzed.
mRNA_ID The identifier of the specific transcript of that gene.
Ref_ID Reference haplotype ID, labeled as transcript:REF.
Alt_IDs Alternative haplotype IDs observed in the samples, with numbering to distinguish multiple haplotypes.
samples The haplotype presence/absence in each sample. Each entry corresponds to the Ref or Alt haplotype. 0 represents REF.

Citation

If you use BRAID in your research, please cite our paper:

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

pybraid-1.0.0.tar.gz (27.2 kB view details)

Uploaded Source

Built Distribution

If you're not sure about the file name format, learn more about wheel file names.

pybraid-1.0.0-py3-none-any.whl (31.4 kB view details)

Uploaded Python 3

File details

Details for the file pybraid-1.0.0.tar.gz.

File metadata

  • Download URL: pybraid-1.0.0.tar.gz
  • Upload date:
  • Size: 27.2 kB
  • Tags: Source
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/6.2.0 CPython/3.9.6

File hashes

Hashes for pybraid-1.0.0.tar.gz
Algorithm Hash digest
SHA256 10d4b3da3e4fc504a9f98e6009c45cbe7c937f165e3dab1b02f2ccd55833c020
MD5 e3cc249c71a2898dd5fb45ea00f4d9bd
BLAKE2b-256 4b5103dad5f8c9f9e35478ca7982760b9b00d926558faeed4e540c33949eee02

See more details on using hashes here.

File details

Details for the file pybraid-1.0.0-py3-none-any.whl.

File metadata

  • Download URL: pybraid-1.0.0-py3-none-any.whl
  • Upload date:
  • Size: 31.4 kB
  • Tags: Python 3
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/6.2.0 CPython/3.9.6

File hashes

Hashes for pybraid-1.0.0-py3-none-any.whl
Algorithm Hash digest
SHA256 f842944a4d7d7585b5f5d368a76a3618ac60ad2011579d39233634de10240b5f
MD5 175576ef893d3a94c7befe49aa680325
BLAKE2b-256 a1b8fc3fe71114b85cb802b3d98d82174a9499711986e3ca120877daf1422d8c

See more details on using hashes here.

Supported by

AWS Cloud computing and Security Sponsor Datadog Monitoring Depot Continuous Integration Fastly CDN Google Download Analytics Pingdom Monitoring Sentry Error logging StatusPage Status page