A package to count the number of repeats in a Short Tandem Repeat Expansion from long reads.
Project description
STRcount
Software tool to analyse STR loci from long read data. STRcount can count the number of repeats in a repeat expansion and give you the count in a tabular format for further downstream analysis.
Release notes
- 0.1.0: Initial release with tools updated on Pypi and ready to use.
Dependencies
Developed and tested on Python 3.7.10. Dependencies include:
Installation instructions
Install GraphAligner
STRcount requires and uses GraphAligner as it's alignment tool. To install this you could either install it using Anaconda:
- Install miniconda https://conda.io/projects/conda/en/latest/user-guide/install/index.html
conda install -c bioconda graphaligner
Or you could install it from source using the instructions here
Installation using pip
Use the following command to install STRcount and all dependencies:
pip install STRcount
Installation from source
git clone https://github.com/sabiqali/strcount.git
cd strcount
python setup.py install
Installation to develop
To develop using STRcount, you will need to create a conda environment or python virtual environment, then perform the following steps:
git clone https://github.com/sabiqali/strcount.git
cd strcount
python -m pip install -r requirements.txt
python ./STRcount/STRcount_wrapper.py -h
Config file format
The config file should be in the following format:
| chr | begin | end | name | repeat | prefix | suffix |
|---|---|---|---|---|---|---|
| chr9 | 27573527 | 27573544 | c9orf72 | GGCCCC | CGGCAGCCGAACCCCAAACAGCCACCCGCCAGGATGCCGCCTCCTCACTCACCCACTCGCCACCGCCTGCGCCTCCGCCGCCGCGGGCGCAGGCACCGCAACCGCAGCCCCGCCCCGGGCCCGCCCCCGGGCCCGCCCCGACCACGCCCC | TAGCGCGCGACTCCTGAGTTCCAGAGCTTGCTACAGGCTGCGGTTGTTTCCCTCCTTGTTTTCTTCTGGTTAATCTTTATCAGGTCTTTTCTTGTTCACCCTCAGCGAGTACTGTGAGAGCAAGTAGTGGGGAGAGAGGGTGGGAAAAAC |
Usage
If installed using pip or from source, you will be able to use it using STRcount else if you have installed to develop, you will be able to use it using python STRcount.py/STRcount_wrapper.py
STRcount.py [-h] --reference REFERENCE --fastq FASTQ --config CONFIG
--output OUTPUT [--min-identity MIN_IDENTITY]
[--min-aligned-fraction MIN_ALIGNED_FRACTION]
[--write-non-spanned]
[--repeat_orientation REPEAT_ORIENTATION]
[--prefix_orientation PREFIX_ORIENTATION]
[--suffix_orientation SUFFIX_ORIENTATION]
[--cleanup CLEANUP] [--output_directory OUTPUT_DIRECTORY]
[--multiseed-DP MULTISEED_DP]
[--precise-clipping PRECISE_CLIPPING]
optional arguments:
-h, --help show this help message and exit
--reference REFERENCE
the reference from which the STR Graph will be
generated
--fastq FASTQ the baseaclled reads in fastq format
--config CONFIG the config file
--output OUTPUT the output file
--min-identity MIN_IDENTITY
only use reads with identity greater than this
--min-aligned-fraction MIN_ALIGNED_FRACTION
require alignments cover this proportion of the query
sequence
--write-non-spanned do not require the reads to span the prefix/suffix
region
--repeat_orientation REPEAT_ORIENTATION
the orientation of the repeat string. + or -
--prefix_orientation PREFIX_ORIENTATION
the orientation of the prefix, + or -
--suffix_orientation SUFFIX_ORIENTATION
the orientation of the suffix, + or -
--cleanup CLEANUP do you want to clean up the temporary file?
--output_directory OUTPUT_DIRECTORY
the output directory for all output and temporary
files
--multiseed-DP MULTISEED_DP
Aligner option
--precise-clipping PRECISE_CLIPPING
Aligner option: use arg as the identity threshold for
a valid alignment.
Output
The output is in a .tsv format that will look something like this:
| read_name | strand | spanned | count | align_score | identity | query_aligned_fraction |
|---|
- read_name: The name of the read that is currently being proccessed
- strand: The strand on which the primary alignment has been detected
- spanned: If set to 1, it means that the read spanned the repeat locus and the flanking sequence
- count: The number of repeat motifs detected at the locus for that particular read
- align_score: The alignment score as given by GraphAligner
- identity: The percentage identity as given by GraphAligner
- query_aligned_fraction: This signifies how much of the query sequence is covered by the alignment
Contact
License
MIT
Project details
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
Built Distribution
Filter files by name, interpreter, ABI, and platform.
If you're not sure about the file name format, learn more about wheel file names.
Copy a direct link to the current filters
File details
Details for the file STRcount-0.0.6.tar.gz.
File metadata
- Download URL: STRcount-0.0.6.tar.gz
- Upload date:
- Size: 5.6 kB
- Tags: Source
- Uploaded using Trusted Publishing? No
- Uploaded via: twine/4.0.1 CPython/3.9.7
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
e823a23a4766b6147ebcb89ad6b5013dd56e12fb71a7691ea17c6b31c8378fb3
|
|
| MD5 |
4f9d86ae91264a9988f1aa2822596e7c
|
|
| BLAKE2b-256 |
4179cd5f06217238ab7de90ad3a3c511031226193b8343721466a65a3c9b4d48
|
File details
Details for the file STRcount-0.0.6-py3-none-any.whl.
File metadata
- Download URL: STRcount-0.0.6-py3-none-any.whl
- Upload date:
- Size: 5.7 kB
- Tags: Python 3
- Uploaded using Trusted Publishing? No
- Uploaded via: twine/4.0.1 CPython/3.9.7
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
6502ec6f3ca2502d182df769e14a447a2dd7541c79899e1fb59bf42ebad2dba4
|
|
| MD5 |
3900b8e09153c09dd95a8ff16c7e1df5
|
|
| BLAKE2b-256 |
6c55691f01145f310ba0a1abf20d09021cb70b91f1f519272285656c3b026f8e
|