Feature extraction and analysis toolkit for antisense oligonucleotide design.
Project description
ASOdesigner
ASOdesigner provides feature extraction utilities that support the design of antisense oligonucleotides (ASOs). The package bundles folding, accessibility, and sequence analysis helpers that were originally created for the TAU-Israel 2025 iGEM project.
Installation
You can install the library directly from PyPI once it is published:
pip install asodesigner
For local development and experimentation inside this repository, install the package in editable mode together with its runtime dependencies:
pip install -r requirements.txt
Usage
Functions are organised by module. For example, to compute a few sequence-derived features:
from asodesigner import seq_features
enc = seq_features.compute_ENC("ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG")
gc = seq_features.get_gc_content("ATGGCC")
Refer to the individual module docstrings for detailed behaviour and expected inputs.
Development Workflow
- Update or add functionality under
src/asodesigner/. - Keep imports relative within the package (for example, use
from .util import helper). - Run
python -m compileall src/asodesigneror your preferred test suite to make sure the code still imports correctly.
Building and Publishing to PyPI
The project uses a modern pyproject.toml driven build. To prepare a release:
- Choose a version – bump the version field in
pyproject.tomlfollowing semantic versioning. - Build the artifacts:
python -m build
- Inspect the build – verify the generated wheel and source distribution under
dist/. - Upload to PyPI (or TestPyPI first) using
twine:python -m twine upload dist/*
Remember that publishing requires a PyPI account and API token. For TestPyPI, swap the repository URL accordingly.
License
The code is released under the Creative Commons Attribution 4.0 International License (CC BY 4.0). See LICENSE for
full details.
Project details
Release history Release notifications | RSS feed
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
Built Distribution
Filter files by name, interpreter, ABI, and platform.
If you're not sure about the file name format, learn more about wheel file names.
Copy a direct link to the current filters
File details
Details for the file asodesigner-0.1.0.tar.gz.
File metadata
- Download URL: asodesigner-0.1.0.tar.gz
- Upload date:
- Size: 66.3 kB
- Tags: Source
- Uploaded using Trusted Publishing? No
- Uploaded via: twine/6.2.0 CPython/3.11.11
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
1aa18951e5bf583d21c666385585e1a8eb9a243ab2e271a9dba277684fbd0107
|
|
| MD5 |
ca5e7eeef5f1bcb420abb8c0e51a448e
|
|
| BLAKE2b-256 |
8921c42fdff214d370d41f1a56a967e9137dfe0f21dd5d4a2d6189028e57fc9f
|
File details
Details for the file asodesigner-0.1.0-py3-none-any.whl.
File metadata
- Download URL: asodesigner-0.1.0-py3-none-any.whl
- Upload date:
- Size: 72.0 kB
- Tags: Python 3
- Uploaded using Trusted Publishing? No
- Uploaded via: twine/6.2.0 CPython/3.11.11
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
214c5b1e88c9144afe3a5cb5ea9013637ea2a8c2f15f8ca9269f2ce2d23c850e
|
|
| MD5 |
139660f3b60cdbdfdd3b5a1b5ef3e5c2
|
|
| BLAKE2b-256 |
e217eea46cf029e6f7f971a4a7181e6f407afb02b974b233380e4bb65281ab48
|