Skip to main content

Analysis of barseq data.

Project description

Build Status Python 3.7

barseq

Python package for analyzing barseq data.

Installation

pip install git+https://github.com/mjmlab/barseq.git@master

Usage

barseq -i <directory of sequencing reads> -b <barcode file> -e <experiment name>

-i / --input

  • Directory with Illumina reads in either fastq or fastq.gz.

-b / --barcodes

  • CSV file with barcode and correspondent gene names.

-e / --experiment

  • Name of experiment, it is used for creating results folder.

Files Needed

Directory of Illumina reads [-i] for analyzing. Can be either fastq or fastq.gz format

@M06026:87:000000000-D69HY:1:1102:15909:1336 1:N:0:TGACCA
CTCTAGAAAGTATAGGAACTTCAGGGCCATTTATATACCTTCCACTCTTCAACCGTGTCTTGACTTGACCTGGATGTCTCTACTGCTGTCATGCTACGTAGCTCATGCTACGTCGATCTAGTCGATGCATGCTAGCTGATCGACTCTCTTC
+
A#>>>3AA2DD>FBFGBFBFBFDDFGGAAEEEHDHFFFDDDBDGDFDDDDDADFGFFDDBFFEBFD5DFEEBBADABFGFGBBFGDD5BF3F43B3F1/11B144BGEBF@BBFB0B0BBFBBBBBBBB?E/FGFBB?/???B???/?FGG

Barcode file [-b] with gene names. Needs to be in CSV format.

Barcode,Gene
ATGAAGACTGTTGCCGTA,WT
CACGACGCCCTCCGCGGA,gene1
ACTATTACGCAAAATAAT,gene2
ATGGAAGATATTATTATT,gene3
CCTCTCCAACCGGGTCTG,gene4
CCCGGTCGCCTAGCCCCG,gene5
GGCCCCCCGCCCGTCCCC,gene6
GGATCACTGCTAGCGTAT,gene7
CCTGCAGCAGCGGCCCGC,gene8
ACACATGCAGACATAGAG,gene9
CGCGCCATCCGCCGCCCA,gene10
AATATTCAGATGGGACGT,gene11

Output

results/ directory

  • <experiment>_results.csv: barcode counts found in each sequence file.
Gene Barcode Sample 1 Sample 2 Sample 3 ...
gene1 ATGAAGACTGTTGCCGTA 500 5 7 ...
gene2 CACGACGCCCTCCGCGGA 12 13 19 ...
gene3 ACTATTACGCAAAATAAT 13 11 10 ...
_other _other 28 40 29 ...

Barseq Workflow

barseq_diagram

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

barseq-1.0.1.tar.gz (7.8 kB view hashes)

Uploaded source

Built Distribution

barseq-1.0.1-py3-none-any.whl (10.9 kB view hashes)

Uploaded py3

Supported by

AWS AWS Cloud computing Datadog Datadog Monitoring Facebook / Instagram Facebook / Instagram PSF Sponsor Fastly Fastly CDN Google Google Object Storage and Download Analytics Huawei Huawei PSF Sponsor Microsoft Microsoft PSF Sponsor NVIDIA NVIDIA PSF Sponsor Pingdom Pingdom Monitoring Salesforce Salesforce PSF Sponsor Sentry Sentry Error logging StatusPage StatusPage Status page