Skip to main content

PyPI version shields.io PyPI license

Bartide

Extract, correct and analyze barcodes from sequenced reads

INSTALLATION

To install Bartide you need to have Python version 3.9 or upwards. The suggest wasy to install Python is to use Miniconda: https://docs.conda.io/en/latest/miniconda.html

Use the following command to install Bartide

pip install bartide

Installation of NMSlib:

Easiet way to install NMSlib is to use the precompiled version from conda-forge repo. This works across Linux, MacOS and Windows machines.

conda install -c conda-forge nmslib

USAGE

1. Extraction

Barcodes are extracted from the sequencing reads using the Bartide’s BarcodeExtractor class. This class is provided two input files, one for each end of paired-end sequencing, in FASTQ format. This class is designed to automatically extract the barcodes assuming that the barcodes are of the same lengths, they span the same position in the reads and the flanking sequence is constant. This is achieved by first summarizing the nucleotide composition at each position for all the reads (or a sample of reads). The flanking sequence will be dominated by a single nucleotide while the barcode should have variable base composition. This pattern is used to identify the position of barcodes and the flanking primer sequence. This behaviour can be overridden by providing the barcode length and the flanking primer sequence to BarcodeExtractor. Below we show an example of how to call the BarcodeExtractor class, and perform automatic flank identification.

import bartide

extractor = bartide.BarcodeExtractor(
	'sample1_read1.fastq.gz',
	'sample1_read2.fastq.gz'
)

extractor.identify_flanks()

Alternatively, users can provide the flanking sequence can the barcode length manually like below:

extractor = bartide.BarcodeExtractor(
	'sample1_read1.fastq.gz',
	'sample1_read2.fastq.gz',
	left_flank='GTAGCC',
	right_flank='AGATCG',
	barcode_length=27
)

Once the flank sequences and barcode length are determined, they are stored as extractor.leftFlank, extractor.rightFlank and extractor.barcodeLength. Now the barcodes can be extracted, and their frequency counted. The BarcodeExtractor class will compare the barcode sequence and its reverse complementary sequence from the other pair of the sequenced read. By default, there should not be more than 3 mismatches between the two sequences otherwise the extraction fails for that read. Users can change the maximum allowed mismatch value by using the max_dist parameter when calling BarcodeExtractor.

The actual extraction of barcodes is triggered by the following command:

extractor.count_barcodes()

Users can access these uncorrected barcodes with the following command:

print (extractor.rawCounts)

This prints the barcodes and their frequencies as shown below:

TTGTAGGGGTGTGTTCTACCGGTAATT    2843
GTGCTGGTAATGTGGGCGACGGTGGGG     913
TTGGTGAAGCATAGTTCCGTGATTGAA     909
TTCCATGACGTTAAATACCTCCTTATA     723
ATCTGGCGTCCAGCAGATATTAGTTTT     717
                               ... 
AAGTTACATGCCGCAAAGGGTTCTTTG       1
AAGGATGAATGACAAGGTGCTAGCCAT       1
GGTACAAGGCGGGATTACCATGCATTG       1
GTGCTGGAAATGTGGGCGACGGTGGGG       1
AAGTCACATGCCGCAAAGTGTCCATTG       1

2. Error correction

Next, the list obtained above may still contain barcodes that harbour sequencing errors. We assume that a barcode contains error(s) if it has less than three nucleotide difference with a higher abundance barcode. Since the pairwise comparison of all the barcodes can be computationally prohibitive, we use approximate nearest neighbour detection library ‘nmslib’ to efficiently identify similar barcodes. If an erroneous barcode is found, its frequency is added to the barcode with the nearest match. This functionality is implemented in the SeqCorrect class. Users can obtain the corrected barcode list, by running the following command:

corrector = bartide.SeqCorrect()
corrector.run(extractor.rawCounts)

The corrected list of barcodes is stored under corrector.correctedCounts. These barcodes can then be saved in CSV format table as shown below:

corrector.save_to_csv('barcodes_freq_sample1.csv')

The SeqCorrect class will by default, remove any barcode with a frequency of less than 20, as suggested previously (Naik et al., 2014). This behaviour can be overridden by changing the value of the min_counts parameter when calling SeqCorrect.

3. Sample comparison, analysis and visualization

Once the corrected barcode frequencies are saved for all the samples, they can be compared using the BarcodeAnalyzer class. This class is initialized by providing the name, with full path, of the directory wherein all the CSV files were saved. The following command illustrates this:

analyzer = bartide.BarcodeAnalyzer(‘barcodes_dir’)

This will lead to aggregation of all the barcodes across all the samples that can be accessed from a single table stored under analyzer.barcodes. Users can perform all the custom downstream analysis using this table as the starting point.

Bartide provides four essential plots that allow users to easily identify how the barcodes are shared across the sample.

The first plot is the ‘Upset’ that shows all the combinations of samples and the number of barcodes that overlap between them. This plot, compared to Venn diagrams, allow easy visualization of the overlaps and non-overlaps of barcodes. Please note that when using upset plots, we only look at the unique number of barcodes found in each of the samples and not their frequencies.

analyzer.plot_upset()
upset_plot

Sometimes due large difference in the number of barcodes captured, it might be difficult to easily identify the similarity or differences between the samples. To solve this, rather than using the absolute number of barcodes in a sample, the percentage overlap of barcodes from a sample with all other samples are used. This allows the barcodes from a sample to be defined in proportions and may allow insights into sample similarity that is otherwise to identify with absolute frequencies. The following command shows the proportions in form of a stacked barplot:

analyzer.plot_stacked()
stacked_plot

An alternative way to deal with the situation wherein the absolute number of unique barcodes are quite different across the samples is to perform normalization by dividing the overlap value by the sum of the total barcodes from the two samples. The resulting normalized values can be visualized in form of a heatmap.

analyzer.plot_overlap_heatmap()
overlap_heatmap

In all the above three plotting functions, we do not the frequencies of the barcodes, which are indicative of how dominant a particular barcode is in the samples. A weighted overlap of barcodes is calculated between two samples as following:

$$\sum_{b}^{B}\left(S_b^i-S_b^j\right)^2$$

Wherein, $S$ is a column-sum normalized matrix of samples (columns) and barcodes (rows) containing barcode frequencies, $i$ and $j$ are two samples, $b$ is a barcode in a set of barcodes $B$ that are present in either of the two samples or both. These overlap values are then plotted in form of a heatmap using the following function:

analyzer.plot_weighted_heatmap()
weighted_heatmap

To save the images generated by the functions above, users can pass a value (path and name of the file where to save) to the save_name parameter.

Metadata

Release files for bartide 0.3.2

For a detailed explanation of source distributions (sdists) and built distributions (wheels), please see the package formats documentation.

Source distribution (sdist)

Source distribution for bartide 0.3.2
File Size Uploaded
bartide-0.3.2.tar.gz 11.9 kB Details

Built distribution (wheel)

Table of built distributions (wheels) for bartide 0.3.2
File Interpreter ABI Platform
bartide-0.3.2-py3-none-any.whl Python 3 none any Details

Total release size: 25.0 kB

Release files / bartide-0.3.2.tar.gz

Download URL bartide-0.3.2.tar.gz
Size 11.9 kB
Tags Source
SHA-256 checksum
How to use checksums
f7d017ae2b2d02699a5014e2218d1ece64baab820d1bef7da9bf471fdc6a8b65
BLAKE2b-256 checksum
How to use checksums
c8ca6331e47a832cbfff5c874c573a42ef807d588a6f7ddaa9cb7c9ef12c4fa2
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
No
Uploaded via twine/4.0.1 CPython/3.9.12

Release files / bartide-0.3.2-py3-none-any.whl

Download URL bartide-0.3.2-py3-none-any.whl
Size 13.1 kB
Tags Python 3
SHA-256 checksum
How to use checksums
e2c7e208819204dccf68ee55d5ffd0b30539c74afdc1ca8a34016e659c994e42
BLAKE2b-256 checksum
How to use checksums
859aaebaba2f7564c23cec1a6b3b3102f97fd4486545afca51999b50c34e5e7e
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
No
Uploaded via twine/4.0.1 CPython/3.9.12

Release history Release notifications | RSS feed

This release

0.3.2 This release

2 release files

0.3.1

2 release files

0.3.0

2 release files

0.2.0

2 release files

0.1.2

2 release files

0.1.1

1 release file

Anthropic, PBC Visionary sponsor Bloomberg Visionary sponsor Hudson River Trading Visionary sponsor Meta Visionary sponsor NVIDIA Visionary sponsor Microsoft Sustainability sponsor Depot Continuous Integration AWS Cloud computing and Security Sponsor Datadog Monitoring Fastly CDN Google Download Analytics Sentry Error logging StatusPage Status page