BIGSdb Downloader
Project description
BIGSdb_downloader
Download alleles and profiles from PubMLST and BIGSdb Pasteur via their API using authentication.
Use in place of wget or curl in download scripts to seamlessly handle the
OAuth authentication required by the BIGSdb API.
Installation
It is recommended that you install this in a virtual environment.
Option 1 (simple, local project)
mkdir ~/bigsdb_downloader
cd ~/bigsdb_downloader
python -m venv .venv
source .venv/bin/activate
pip install bigsdb-downloader
You can deactivate the enviroment with:
deactivate
Then run with:
~/bigsdb_downloader/.venv/bin/bigsdb-downloader
Option 2 (recommended for command line use):
pipx install bigsdb-downloader
Then run with:
bigsdb-downloader
Option 3 (for scheduled jobs/cron):
python -m venv ~/venvs/bigsdb-downloader
~/venvs/bigsdb-downloader/bin/pip install bigsdb-downloader
Then run with:
~/venvs/bigsdb-downloader/bin/bigsdb-downloader
Accessing PubMLST and BIGSdb Pasteur APIs using authentication
The BIGSdb platform used for PubMLST and BIGSdb Pasteur uses OAuth authentication that enables you to delegate access using your account to a script without having to share credentials.
1. First you need to register an account for the appropriate site (see https://pubmlst.org/site-accounts).
The addresses you need to do this are:
- PubMLST: https://pubmlst.org/bigsdb
- Pasteur: https://bigsdb.pasteur.fr/cgi-bin/bigsdb/bigsdb.pl
2. You then need to register this account with each database that you want to access. This can also be done at the above addresses. Note that BIGSdb can now be configured to auto-register new accounts for every unrestricted public database, so this step may no longer be necessary.
3. Finally, you will need to obtain a client key and secret.
- For PubMLST, you can now create a personal key at https://pubmlst.org/bigsdb.
- For Pasteur, please find details at https://bigsdb.pasteur.fr/requesting-api-key/.
Credential setup
The script will handle multiple keys for each site if necessary - you can call these what you like but normally you would just have one that you can name the same as the site. To set up the credentials for the first time run with the --setup option and provide the name of any database configuration that your account has access to, e.g.
bigsdb-downloader --key_name PubMLST --site PubMLST --db pubmlst_neisseria_isolates --setup
This will then prompt you to enter the client key and client secret that you have obtained. These will be stored in the token_directory (./.bigsdb_tokens by default but can be set using --token_dir argument).
You will then be prompted to login to a particular page on the BIGSdb site and authorize delegation of your account access. This will provide you with a verification code that you will be prompted to enter by the script. Once done an access token will be saved that will be used for all future access. This token is valid for all databases on the site that your account is registered for.
Session tokens will be obtained and renewed automatically by the script as required using your client key and access token.
Downloading data
To download you would run something like the following:
bigsdb-downloader --key_name PubMLST --site PubMLST --url "https://rest.pubmlst.org/db/pubmlst_neisseria_seqdef/schemes/1/profiles_csv"
It is also possible to use HTTP POST method calls and include a JSON payload. For example, to perform a BLAST query of a single abcZ sequence against the MLST scheme in the Neisseria database you can do:
bigsdb-downloader --key_name PubMLST --site PubMLST --url "https://rest.pubmlst.org/db/pubmlst_neisseria_seqdef/schemes/1/sequence" --method POST --json_body '{"sequence":"TTTGATACCGTTGCCGAAGGTTTGGGCGAAATTCGTGATTTATTGCGCCGTTATCATCATGTCAGCCATGAGTTGGAAAATGGTTCGAGTGAGGCTTTGTTGAAAGAACTCAACGAATTGCAACTTGAAATCGAAGCGAAGGACGGCTGGAAACTGGATGCGGCAGTCAAGCAGACTTTGGGGGAACTCGGTTTGCCGGAAAATGAAAAAATCGGCAACCTTTCCGGCGGTCAGAAAAAGCGCGTCGCCTTGGCTCAGGCTTGGGTGCAAAAGCCCGACGTATTGCTGCTGGACGAGCCGACCAACCATTTGGATATCGACGCGATTATTTGGCTGGAAAATCTGCTCAAAGCGTTTGAAGGCAGCTTGGTTGTGATTACCCACGACCGCCGTTTTTTGGACAATATCGCCACGCGGATTGTCGAACTCGATC"}'
For payloads larger than the command line character limit, e.g. whole genome assemblies, you can write the JSON payload to a temporary file and pass this filename as an option. For example to query a FASTA file, contigs.fasta, against the same scheme you can do:
file_contents=$(base64 -w 0 contigs.fasta)
json_body=$(echo -n '{"base64":true,"details":false,"sequence": "'; echo -n "$file_contents"; echo '"}')
echo "$json_body" > temp.json
bigsdb-downloader --key_name PubMLST --site PubMLST --url "https://rest.pubmlst.org/db/pubmlst_neisseria_seqdef/schemes/1/sequence" --method POST --json_body_file temp.json
Options
bigsdb-downloader --help
usage: bigsdb-downloader [-h] [--cron] [--db DB] [--json_body JSON_BODY] [--json_body_file JSON_BODY_FILE] --key_name
KEY_NAME [--method {GET,POST}] [--output_file OUTPUT_FILE] [--setup]
[--site {PubMLST,Pasteur}] [--token_dir TOKEN_DIR] [--url URL]
options:
-h, --help show this help message and exit
--cron Script is being run as a CRON job or non-interactively.
--db DB Database config - only needed for setup.
--json_body JSON_BODY
JSON body to be included in a POST call. If this is longer than the command line limit (probably
about 128kb) then you will need to save the JSON payload to a file and use --json_body_file
--json_body_file JSON_BODY_FILE
File containing JSON to use in the body of a POST call.
--key_name KEY_NAME Name of API key - use a different name for each site.
--method {GET,POST} HTTP method
--output_file OUTPUT_FILE
Path and filename of saved file. Output sent to STDOUT if not specified.
--setup Initial setup to obtain access token.
--site {PubMLST,Pasteur}
--token_dir TOKEN_DIR
Directory into which keys and tokens will be saved.
--url URL URL for API call.
API documentation
You can find details about all the API routes that you can call at https://bigsdb.readthedocs.io/en/latest/rest.html.
Project details
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
Built Distribution
Filter files by name, interpreter, ABI, and platform.
If you're not sure about the file name format, learn more about wheel file names.
Copy a direct link to the current filters
File details
Details for the file bigsdb_downloader-1.0.6.tar.gz.
File metadata
- Download URL: bigsdb_downloader-1.0.6.tar.gz
- Upload date:
- Size: 46.2 kB
- Tags: Source
- Uploaded using Trusted Publishing? No
- Uploaded via: twine/6.2.0 CPython/3.12.3
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
31fd7ec39398488344950da34fdbb663bd9073b44da6dbc3d03945cc17900766
|
|
| MD5 |
620f18d121720a6d1131b0a74325a25b
|
|
| BLAKE2b-256 |
1f27d6f7cddc46e9ab387906e54c0e98a507e122d8cfb24b82240bc3d3a067cc
|
File details
Details for the file bigsdb_downloader-1.0.6-py3-none-any.whl.
File metadata
- Download URL: bigsdb_downloader-1.0.6-py3-none-any.whl
- Upload date:
- Size: 32.9 kB
- Tags: Python 3
- Uploaded using Trusted Publishing? No
- Uploaded via: twine/6.2.0 CPython/3.12.3
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
a44d35c296bc420df6269b84bf9879f744007357fbf5eb63454c1903cb88c199
|
|
| MD5 |
d137ed91e571cbf05adff011a1117fa5
|
|
| BLAKE2b-256 |
10cbc7f684dac9ae1604a3ee33378f81716d7a37f93cc18c3283325328e5a255
|