bioforge 4.0.1

High-performance bioinformatics engine for Edge Computing — 5-bit encoding, vectorised NumPy core, optional C backend

BioForge — High-Performance Bioinformatics Engine

A bioinformatics engine built for Edge Computing.
No Biopython. No heavy dependencies. NumPy core + optional C engine for maximum speed.

---

Why this exists

Most bioinformatics tools are built for servers with gigabytes of RAM.
BioForge was built for the opposite: low-power hardware, minimal footprint, maximum speed — running genetic analysis offline and locally.

Two core rules:

• Zero Python loops in the hot path — every operation is vectorised with NumPy.
• 5-bit encoding — every biological symbol fits in 5 bits, saving 37.5% memory vs ASCII.

---

Key numbers

Operation	Result
Memory (30M bases)	18.75 MB (37.5% less than plain ASCII)
Translation throughput	~5 M amino acids / second (NumPy) · ~27× faster with C engine
NW alignment 1000×1000 nt	~165 ms (NumPy) · ~29× faster with C engine
FASTA ingestion (C batch parser)	~80 M bases / second
FASTQ ingestion (C batch parser)	~14 M bases / s · ~94 K reads / s
QC filter 200 K reads (columnar)	0.28 s — 18.6× faster than per-record
vs Biopython — QC filter	~5–6× faster, identical result
vs Biopython — load all in RAM	~6.9× less memory (115 MB vs 801 MB) · ~9.5× faster
Compressed input	.gz read transparently in C (zlib, static-linked)
Dependencies	NumPy (C engine included, pre-compiled)

---

Architecture

┌──────────────────────────────────────────────────────────────┐
│  Level 3 — bioforge/aligner.py           NW alignment         │
│  Anti-diagonal wavefront O(m+n) · mutation detection         │
├──────────────────────────────────────────────────────────────┤
│  Level 2 — bioforge/smart_translator.py  DNA → Protein       │
│  CODON_LUT + sliding_window_view · first-ATG ORF detection   │
├──────────────────────────────────────────────────────────────┤
│  Level 1 — bioforge/biocore.py           5-bit storage        │
│  BitPacker · PackedSequence · SmartImporter · LUTs           │
├──────────────────────────────────────────────────────────────┤
│  C engine — bioforge/engine/engine.c     Optional backend     │
│  GCC -O3 -march=native -fopenmp · auto-loaded via ctypes     │
└──────────────────────────────────────────────────────────────┘

The 5-bit unified alphabet

Every biological symbol — nucleotides, amino acids, gaps, stop codons and ambiguous bases — fits in a single 5-bit scheme (32 states).
One encoding covers DNA, RNA, and proteins in the same pipeline.

State  Symbol            State  Symbol
  0    Adenine   (A)      14    Methionine    (M)
  1    Cytosine  (C)      ...   (all 20 amino acids: 4–23)
  2    Guanine   (G)      24    STOP codon    (*)
  3    Thymine / Uracil   25    Alignment gap (-)
 4–23  Amino acids        31    Unknown / ambiguous

---

Installation

git clone https://github.com/erlanders177/bioforge.git
cd bioforge
pip install -r requirements.txt      # only needs NumPy

Requirements

• Python ≥ 3.10
• NumPy ≥ 1.24 — the only runtime dependency
• The C engine ships pre-compiled (engine.dll, zlib statically linked). If it can't load on your platform, BioForge falls back to NumPy automatically.

Optional — compile the C engine (27–29× faster on translation and alignment):

python bioforge/engine/build.py

Requires GCC. On Windows: MinGW-w64. On Linux/Mac: sudo apt install gcc / brew install gcc.
If not compiled, BioForge falls back to NumPy automatically — no code changes needed.

For development and testing:

pip install hypothesis pytest pytest-benchmark

---

Quick start

Import and encode a FASTA sequence

from bioforge import SmartImporter, SeqType

records = SmartImporter.from_string(""">gene_1
ATGGTGCACCTGACTCCTGAGGAGAAGTCTGCC
""")

seq = records[0]
print(seq.n_symbols)      # 33
print(len(seq.data))      # 21  (37.5% smaller than ASCII)
print(seq.to_string())    # ATGGTGCACCTGACTCCTGAGGAGAAGTCTGCC

Stream a huge FASTA/FASTQ with constant RAM

from bioforge import SmartImporter

# One PackedSequence at a time — never loads the whole file
for seq in SmartImporter.stream("genome.fa"):
    print(seq.header, seq.n_symbols)

# FASTQ yields FastqRecord (sequence + Phred qualities)
for rec in SmartImporter.stream_fastq("reads.fastq"):
    if rec.passes_quality(20):
        process(rec.sequence)

Quality-filter millions of reads — the fast lane (columnar)

from bioforge import SmartImporter

total = passed = 0
for batch in SmartImporter.stream_fastq_batches("reads.fastq"):
    mask = batch.passes(20)          # ONE NumPy op for thousands of reads
    total  += len(batch)
    passed += int(mask.sum())
    kept = batch.filter(mask)        # new ReadBatch, no per-read objects
print(f"{passed}/{total} reads with mean quality >= 20")

stream_fastq_batches keeps a whole batch as contiguous matrices instead of one object per read, so filtering 200 000 reads drops from ~5.3 s to ~0.28 s. Materialise a single read only when you need it: batch[i] → FastqRecord.

Compressed .gz files are read transparently (decompressed in C):

for rec in SmartImporter.stream_fastq("reads.fastq.gz"):   # no manual gunzip
    ...

Pass n_threads to go multi-core (an adaptive dispatcher picks the best path):

# plain → parallel parse · .gz → libdeflate (~2× faster) + parse
for batch in SmartImporter.stream_fastq_batches("reads.fastq.gz", n_threads=0):
    ...   # n_threads: 1 = sequential (constant RAM) · >1 = threads · 0 = all cores

Reading compressed FASTQ is ~1.6× faster this way (libdeflate beats zlib); plain-file parse parallelism is memory-bandwidth bound, so its gain is modest on few cores but scales on many-core servers.

BGZF — parallel-decompressible .gz (~2× faster reads)

A BGZF file is a valid .gz (any gunzip reads it) but split into independent 64 KB blocks, so BioForge decompresses it across all cores. Convert once a file you'll process repeatedly:

python -m bioforge.bgzf reads.fastq        # or: bioforge-bgzip reads.fastq
# → reads.fastq.gz (BGZF). Reads at ~113 M bases/s vs ~58 for plain .gz.

BioForge auto-detects BGZF and routes to the parallel path; plain .gz keeps using single-thread libdeflate.

GC content and k-mer spectrum — vectorised over a whole batch

from bioforge import SmartImporter

spectrum = None
for batch in SmartImporter.stream_fastq_batches("reads.fastq"):
    gc = batch.gc_content()              # GC fraction per read (NumPy array)
    s  = batch.kmer_spectrum(k=4)        # counts of all 4^4 k-mers in the batch
    spectrum = s if spectrum is None else spectrum + s
# spectrum[i] = how many times k-mer #i appears across the whole file

Both run with zero per-read objects; ambiguous bases (N) are skipped from k-mers.

Fast FASTQ quality report (FastQC-style)

python -m bioforge.qcreport reads.fastq.gz        # or: bioforge-qc reads.fastq.gz

One pass, constant RAM. Reports read/base counts, length, overall GC, mean quality, %reads ≥ Q20/Q30, plus per-read quality and GC histograms, per-position mean quality (the FastQC signature plot) and per-base composition — all built on the columnar API. Use -o report.txt to save it.

Translate DNA to protein

from bioforge import SmartTranslator

protein = SmartTranslator.translate(seq)
print(protein.to_string())   # MVHLTPEEKSA

Detect mutations between two sequences

from bioforge import SequenceAligner, format_alignment

result = SequenceAligner.align(seq_ref, seq_query)

print(f"Identity: {result.identity:.1%}")
print(format_alignment(result))

for mut in result.mutations:
    print(mut)
# Mutation(kind='substitution', pos_a=18, pos_b=18, sym_a='A', sym_b='T')

Map long reads to a genome (Level 4 — seed-chain-align)

Locate reads in a reference far beyond what the O(m·n) aligner can handle, minimap2-style: minimizer seeding → chaining (C DP) → banded extension.

from bioforge import GenomeAligner

# Single sequence, or a whole multi-contig genome:
mapper = GenomeAligner({"chr1": chr1_seq, "chr2": chr2_seq, "plasmid": p_seq})

for m in mapper.map(read):
    print(m.to_paf())                # standard PAF, one line per mapping
    print(m.target_name, m.strand, m.target_start, f"{m.identity:.1%}")

# Map many reads in parallel (uses processes):
results = mapper.map_batch(reads, n_processes=0)   # 0 = all cores

Handles multi-chromosome references (reports the contig + local coordinates), both strands, aligns the full read, tolerates mismatches/indels, and reports a mapping quality. The minimizer and chaining kernels run in the C engine (with NumPy fallbacks).

Speed, honestly: indexing is fast, but read mapping is not yet competitive with hand-tuned C mappers like minimap2 — the mapping pipeline is being moved into the C engine. Use BioForge's mapper where its strengths fit: pure-Python/NumPy core, tiny footprint, pip install and go, no C toolchain.

Full mutation analysis pipeline (DNA + protein)

from bioforge import run, build_report

result = run("reference.fa", "query.fa", mode="both")
print(build_report(result))

Error handling

from bioforge import BioForgeError, TranslationError, SmartImporter, SmartTranslator

try:
    for rec in SmartImporter.stream_fastq("reads.fastq.gz"):
        protein = SmartTranslator.translate(rec.sequence)
except TranslationError as e:
    print(f"Translation failed: {e}")   # e.g. no ATG found
except BioForgeError as e:
    print(f"BioForge error: {e}")       # ANY engine error: parse, I/O, decompress…

One exception family. Every engine error subclasses BioForgeError, so a single except BioForgeError catches them all — translation, alignment, parsing, file I/O (BioForgeIOError), engine/decompression (EngineError). Each also subclasses the matching builtin (ValueError, OSError, RuntimeError…), so existing except OSError-style code keeps working.

Run the verifier (no coding knowledge required)

python check.py

---

Project structure

bioforge/               Python package — all core modules
  __init__.py           Public API entry point (from bioforge import ...)
  biocore.py            Level 1 — 5-bit storage engine
  smart_translator.py   Level 2 — DNA → protein translation
  aligner.py            Level 3 — pairwise alignment + mutation detection
  analyze.py            Full pipeline: DNA + protein analysis, report generation
  qcreport.py           Fast FASTQ quality report (FastQC-style, columnar)
  bgzf.py               BGZF converter (parallel block gzip) — bioforge-bgzip
  engine/
    engine.c            C source — pack, unpack, NW align, translate (GCC -O3)
    engine.dll          Compiled C backend (Windows)
    _loader.py          ctypes wrapper with automatic NumPy fallback

check.py                Non-programmer verifier (runs all checks automatically)
conftest.py             Pytest fixtures shared across all tests

tools/
  visor.py              Interactive step-by-step translator (CLI)
  comparador.py         Sequence comparator tool (CLI)
  stress_test.py        30M-base performance benchmark
  bench_vs_biopython.py BioForge vs Biopython: time + RAM (FASTQ parse/QC/load)

tests/
  test_biocore.py       L1: property-based tests (Hypothesis) + benchmarks
  test_translator.py    L2: genetic code correctness + error paths
  test_aligner.py       L3: alignment properties + mutation detection
  test_analyze.py       Pipeline: full integration tests + CLI tests
  test_streaming.py     Streaming/batch parser + columnar API (Sequence/ReadBatch)
  test_qcreport.py      FASTQ quality report (qcreport.py)

docs/
  architecture.md       Design rules, levels, encoding details
  api_reference.md      Code examples for every module
  benchmarks.md         Measured numbers and methodology
  roadmap.md            Status and planned extensions

---

How the vectorisation works

Translation (Level 2)

① decode PackedSequence → uint8 array  [0–3 per nucleotide]
② find first ATG        → C engine scan / NumPy sliding_window_view
③ extract ORF, reshape  → (N, 3) codon matrix
④ base-4 index          → idx = n₁×16 + n₂×4 + n₃  (vectorised)
⑤ CODON_LUT[idx]        → amino acid array  (single fancy-index)
⑥ argmax on STOP mask   → truncate at stop codon

Alignment (Level 3)

Needleman-Wunsch has a cell-level data dependency that prevents full 2D vectorisation. The solution: anti-diagonal wavefront.

Cells on the same anti-diagonal (i + j = d) are mutually independent, so each diagonal is a single vectorised operation.
Python-level iterations: O(m+n) instead of O(m·n).

When the C engine is available, the entire DP matrix is computed in C with OpenMP, giving ~29× speedup over the NumPy wavefront.

C engine

bioforge/engine/engine.c provides optimised implementations of all hot-path operations. Loaded automatically via ctypes at import time.
If engine.dll is missing, all code falls back to NumPy silently.

from bioforge.engine._loader import C_AVAILABLE
print(C_AVAILABLE)   # True if C engine loaded, False if using NumPy fallback

---

Running the tests

# Full test suite (269 tests)
pytest tests/ -v

# Benchmarks only
pytest tests/ --benchmark-only

# Quick smoke check (no coding knowledge required)
python check.py

---

Known limitations

Limitation	Detail
Aligner memory (full NW)	O(m·n) matrix — sequences > 15 000 bp may exhaust RAM. Use band=N for large sequences.
Protein auto-detection	Sequences without E/F/I/L/P/Q/* are classified as nucleotides. Use force_type=SeqType.PROTEIN to override.
C engine	Pre-compiled .dll/.so not included. Run python bioforge/engine/build.py to compile. Requires GCC.
Banded NW (NumPy fallback)	Without the C engine, banded NW uses the full matrix with NEG_INF masking — same result, standard RAM.

---

Roadmap

• Level 1 — 5-bit storage, FASTA parser, SmartImporter
• Level 2 — vectorised genetic code translation (C + NumPy)
• Level 3 — Needleman-Wunsch alignment + mutation detection (C + NumPy)
• Full mutation analysis pipeline (DNA + protein, 3 modes)
• BioForgeError exception hierarchy for library users
• Reverse complement vectorised — PackedSequence.reverse_complement()
• 6-frame translation — SmartTranslator.translate_all_frames()
• Banded NW — SequenceAligner.align(seq_a, seq_b, band=N)
• Smith-Waterman local alignment — SequenceAligner.align_local()
• Streaming FASTA/FASTQ parser in C — SmartImporter.stream() / stream_fastq()
• Batch parser (5-bit encoding in C) — ~80 M bases/s FASTA, ~94 K reads/s FASTQ
• Columnar QC API — stream_fastq_batches() · ReadBatch.passes() / filter()
• Compressed .gz decoded in C (zlib, static-linked, transparent)
• Object-free columnar k-mer spectrum + per-read GC — kmer_spectrum() / gc_content()
• Benchmark vs Biopython — tools/bench_vs_biopython.py
• Fast FASTQ quality report (FastQC-style) — bioforge-qc / bioforge.qcreport
• Adaptive multi-core dispatcher — n_threads=: parallel parse + libdeflate .gz
• BGZF parallel-decompressible .gz + converter — bioforge-bgzip
• Native per-platform wheels on PyPI (cibuildwheel)
• Long-read / genome-scale aligner (k-mer seeding)

---

References & inspiration

BioForge's genome mapper (Level 4) is an independent, from-scratch implementation of well-established, published algorithms. No third-party source code is included or copied — only the ideas from the scientific literature, which is what publishing them is for. With gratitude to:

• Minimap2 — Li, H. (2018). Minimap2: pairwise alignment for nucleotide sequences. Bioinformatics, 34(18), 3094–3100. The seed-chain-align strategy and the chaining dynamic program that inspired genomemap.py. (paper · MIT-licensed source)
• Minimizers — Roberts, M., Hayes, W., Hunt, B. R., Mount, S. M., & Yorke, J. A. (2004). Reducing storage requirements for biological sequence comparison. Bioinformatics, 20(18), 3363–3369. The (w, k) minimizer sampling behind minimizers.py.
• Needleman–Wunsch (1970) and Smith–Waterman (1981) — the classic dynamic-programming alignments behind Level 3.

BioForge is not affiliated with or endorsed by the authors of the above.

---

Author

Aarón Aranda Torrijos — github.com/erlanders177

---

License

PolyForm Noncommercial 1.0.0 — free for personal, academic and research use.
Commercial use requires explicit permission from the author.

See LICENSE for full terms.