biotools-mcp

Verified bioinformatics tools for AI agents — sequence utilities + statistics, backed by BioPython/scipy, exposed as an MCP server, companion Skill, and Python package.

MIT · public · benchmarked.

Research agents hallucinate bioinformatics math. This project builds the missing layer: battle-tested scientific computation wrapped in a clean, agent-native surface.

What's inside

• Sequence utilities — GC content, reverse complement, translation, ORF finding, motif scanning, sequence stats (BioPython-backed; ORF finder + motif-overlap are custom logic, checked against independent references).
• Statistics — descriptive stats, t-test, chi-square, Mann–Whitney U, correlation (scipy-backed, reference-vector tested against published/R values).
• MCP server — stdio + streamable HTTP, 11 action-oriented tools (seq_gc_content, stats_t_test, …), pydantic v2 schemas with structured output.
• Companion Skill — agentskills.io spec: when to use which tool, input requirements, and what not to do.

Every tool is reference-vector tested against published values (GenBank records, R t.test output, Mendel's 1866 pea counts, Anscombe's quartet) — never against the wrapper itself.

Install

Published on PyPI as biotools-mcp (requires Python 3.11+).

# Install as a standalone CLI (MCP server entry point)
uv tool install biotools-mcp

# Or run without installing
uvx biotools-mcp

# Or plain pip
pip install biotools-mcp

As a library:

uv add biotools-mcp

from biotools_mcp.seq import gc_content
from biotools_mcp.stats import t_test

print(gc_content("ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG").gc_percent)  # 56.4103
print(t_test([1, 2, 3], [4, 5, 6]).statistic)                          # -3.6742

MCP configuration

Point your agent at the server over stdio:

Claude Code (.mcp.json):

{
  "mcpServers": {
    "biotools-mcp": {
      "command": "uvx",
      "args": ["biotools-mcp"]
    }
  }
}

Cursor — Settings → MCP → Add:

{
  "mcpServers": {
    "biotools-mcp": {
      "command": "uvx",
      "args": ["biotools-mcp"]
    }
  }
}

Codex / Gemini CLI — same mcpServers block in the agent's MCP config file.

Streamable HTTP (for remote use):

uvx biotools-mcp --transport streamable-http

Tools

Benchmarks

Wedge subset of BioAgent Bench + BioTaskBench (sequence utilities + statistics) run against the tools and published in benchmarks/results.md. Every task in the subset runs — failures are published alongside passes.

Current: 15/15 passed (100%) — bioagent-bench subset 7/7, bioTaskBench subset 8/8. Pinned harness, see the results file for task-level detail.

uv run python benchmarks/run_bioagent_bench.py    # 7/7
uv run python benchmarks/run_biotaskbench.py      # 8/8
uv run python benchmarks/harness.py --suite all   # combined 15/15

Companion Skill

The skills/biotools-mcp skill (agentskills.io spec) teaches agents the tool inventory, when to use which tool, input requirements, and what not to do (never compute GC/translation/t-tests by hand). Load it into any skills-compatible agent.

Documented solutions

Past problems and the patterns they produced live in docs/solutions — including the uvx grandchild-process leak in subprocess tests, mcp SDK v2 tool-registration conventions, and the CI matrix Python-version trap. Relevant when implementing or debugging in those areas.

Development

uv sync --extra dev
uv run pytest          # reference-vector suite (skips slow packaging by default)
uv run python benchmarks/harness.py --suite all   # regenerate benchmark results
uvx ruff check src tests benchmarks

CI runs lint + tests on Python 3.11/3.12; a nightly workflow regenerates the benchmark table; a tag-pushed v* triggers the PyPI publish workflow.

Contributing

See CONTRIBUTING.md — verification is non-circular (reference-vector fixtures from published values), degenerate inputs must fail loudly, and benchmark tasks are never dropped to keep numbers green. Changes are tracked in CHANGELOG.md.

License

MIT — see LICENSE.