Skip to main content

Software package to design bridge RNAs as described by Durrant & Perry et al. 2024 and Perry et al. 2025

Project description

BridgeRNADesigner

A command line interface for designing bridge RNAs for bridge editing. Accompanies the papers "Bridge RNAs direct modular and programmable recombination of target and donor DNA", Durrant & Perry et al. (2024), and "Megabase-scale human genome rearrangement with programmable bridge recombinases", Perry et al. (2025).

Dependencies

  • Tested on python 3.8
  • Tested on Linux and Mac

Installation

pip install bridgernadesigner

Usage

Command to design a bridge RNA for a given target and donor sequence, and a bridge RNA scaffold.

brna-design --target ATCAGGCCTACGTC --donor ACAGTATCTTGTAT --scaffold ISCro4_enhanced

Example output:

>BridgeRNA_tgt_ATCAGGCCTACGTC_dnr_ACAGTATCTTGTAT_scaffold_ISCro4_enhanced
AGTGCAGGGAGAACCGGCCAGTTCTCTCTGCCATGCGGTCCGCATGCCGTATCAGGCCTTGGGCTAATAACCCGTGACGTAGATTGGCAGCGGACCGCGCCGTTCTCCACAAGTGACAAACCGGACAGTATCATGGACCGGTTTTCCCGGTAATCCGCATTCACAAGGCTGGTCTCACTTGTGGAGAACG
>BridgeRNA_tgt_ATCAGGCCTACGTC_dnr_ACAGTATCTTGTAT_scaffold_ISCro4_enhanced_split_tbl
AGTGCAGGGAGAACCGGCCAGTTCTCTCTGCCATGCGGTCCGCATGCCGTATCAGGCCTTGGGCTAATAACCCGTGACGTAGATTGGCAGCGGACCGC
>BridgeRNA_tgt_ATCAGGCCTACGTC_dnr_ACAGTATCTTGTAT_scaffold_ISCro4_enhanced_split_dbl
CGTTCTCCACAAGTGACAAACCGGACAGTATCATGGACCGGTTTTCCCGGTAATCCGCATTCACAAGGCTGGTCTCACTTGTGGAGAACG

This should run very quickly on a Mac or Linux machine. There is also an option to output the sequence in Stockholm format with multiple tracks.

brna-design --target ATCAGGCCTACGTC --donor ACAGTATCTTGTAT --scaffold ISCro4_enhanced -of stockholm
# STOCKHOLM 1.0
BridgeRNA_tgt_ATCAGGCCTACGTC_dnr_ACAGTATCTTGTAT_scaffold_ISCro4_enhanced     AGTGCAGGGAGAACCGGCCAGTTCTCTCTGCCATGCGGTCCGCATGCCGTATCAGGCCTTGGGCTAATAACCCGTGACGTAGATTGGCAGCGGACCGCGCCGTTCTCCACAAGTGACAAACCGGACAGTATCATGGACCGGTTTTCCCGGTAATCCGCATTCACAAGGCTGGTCTCACTTGTGGAGAACG
#=GC bRNA_template                                                           AGTGCAGGGAGAACCGGCCAGTTCTCTCTGCCATGCGGTCCGCATGCCGTNNNNNNNNNTGGGCTAATAACCCGTNNNNNNNNNTGGCAGCGGACCGCGCCGTTCTCCACAAGTGACAAACCGGNNNNNNNNATGGACCGGTTTTCCCGGTAATCCGCNNTCNNNNNNNTGGTCTCACTTGTGGAGAACG
#=GC guides                                                                  ..................................................LLLLLLLCC................RRRRRCCHH........................................lllllllc..........................rr..rrrcchh.....................
//

In the #=GC guides track, the L character indicates the programmable nucleotides of the LTG, the R character indicates the programmable nucleotides of the RTG, the C character indicates the guide nucleotides of the target core, the H character indicates the position of the programmable handshake guide nucleotides, the l character indicates the programmable nucleotides of the LDG, the r character indicates the programmable nucleotides of the RDG, the c character indicates the guide nucleotides of the donor core, and the h character indicates the position of the programmable handshake guide nucleotides.

Citation

Please cite the linked publications above if you use any aspect of this code in your work.

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

bridgernadesigner-0.1.1.tar.gz (6.0 kB view details)

Uploaded Source

Built Distribution

If you're not sure about the file name format, learn more about wheel file names.

bridgernadesigner-0.1.1-py3-none-any.whl (7.4 kB view details)

Uploaded Python 3

File details

Details for the file bridgernadesigner-0.1.1.tar.gz.

File metadata

  • Download URL: bridgernadesigner-0.1.1.tar.gz
  • Upload date:
  • Size: 6.0 kB
  • Tags: Source
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/6.1.0 CPython/3.8.20

File hashes

Hashes for bridgernadesigner-0.1.1.tar.gz
Algorithm Hash digest
SHA256 668c7ab6d3ac899d482a82cbbb38477dba5bafc1f8a08869db3d6add2e9c633b
MD5 4be439ab57ce963bbd36d471f839cd97
BLAKE2b-256 96d7c48d7376f35033378c18e5c04902dc3d70f58a30a48d9041e5d27fe25e78

See more details on using hashes here.

File details

Details for the file bridgernadesigner-0.1.1-py3-none-any.whl.

File metadata

File hashes

Hashes for bridgernadesigner-0.1.1-py3-none-any.whl
Algorithm Hash digest
SHA256 8a995a29d7e2633467741d7c435c6d6ee0b1694a162685a4c4318076824167b5
MD5 f890c1b26fcd0dcdd13405154f8247e8
BLAKE2b-256 fcaa86c4bb48d9391832b786015da289a541b88b22064b607f417e5f9526b57f

See more details on using hashes here.

Supported by

AWS Cloud computing and Security Sponsor Datadog Monitoring Depot Continuous Integration Fastly CDN Google Download Analytics Pingdom Monitoring Sentry Error logging StatusPage Status page