clonmapper reference genome generator
Project description
Clongen: ClonMapper Reference Generator
Installation
pipx install clongen
python3 <(curl -fsSL viv.dayl.in/viv.py) shim clongen
For one-time use consider using viv run
to use an ephemeral venv, see below for an example.
NOTE: make sure to separate viv
and clongen
flags with --
python3 <(curl -fsSL viv.dayl.in/viv.py) run \
clongen -- --lineages ./lineages.csv
Usage
To generate a clonmapper-compatible reference genome we
first need to produce a fasta
and gtf
file of our expected lineages.
This is where clongen
comes in.
The only input is a single csv
that can come in one of two forms.
id,lineage
lineage1,ATGATCATGGTACCATAAGG
...
You may also provide a simpler version with only lineage sequences:
ATGATCATGGTACCATAAGG
...
The header is optional, however we will only attempt to match with id,lineage
or lineage
.
Any other header will likely not be removed and assumed to be a lineage and id.
If the input list contains id's these will be used as the gene_name
.
Otherwise we will use the full lineage sequence proceeded by the prefix designated by prefix flag, by default "lin-".
Then we can generate clonmapper.gtf
and clonmapper.fa
by default in ./references
:
clongen --lineages ./lineages.csv
Project details
Release history Release notifications | RSS feed
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
Built Distribution
Hashes for clongen-2023.1001-py3-none-any.whl
Algorithm | Hash digest | |
---|---|---|
SHA256 | adbf6cd35ef9b64f66468af85e1d563282ccac45eeae756655f1c2707347b89e |
|
MD5 | 52c5ada5faac990e2b80d4275ec6e70a |
|
BLAKE2b-256 | 7407e77cb521aad161c9516a32f2258016952e64ca485ed3c70587b1dc53c39e |