Skip to main content

clonmapper reference genome generator

Project description

Clongen: ClonMapper Reference Generator

Installation

pipx install clongen 
python3 <(curl -fsSL viv.dayl.in/viv.py) shim clongen

For one-time use consider using viv run to use an ephemeral venv, see below for an example.

NOTE: make sure to separate viv and clongen flags with --

python3 <(curl -fsSL viv.dayl.in/viv.py) run \
  clongen -- --lineages ./lineages.csv

Usage

To generate a clonmapper-compatible reference genome we first need to produce a fasta and gtf file of our expected lineages. This is where clongen comes in. The only input is a single csv that can come in one of two forms.

id,lineage
lineage1,ATGATCATGGTACCATAAGG
...

You may also provide a simpler version with only lineage sequences:

ATGATCATGGTACCATAAGG
...

The header is optional, however we will only attempt to match with id,lineage or lineage. Any other header will likely not be removed and assumed to be a lineage and id.

If the input list contains id's these will be used as the gene_name. Otherwise we will use the full lineage sequence proceeded by the prefix designated by prefix flag, by default "lin-".

Then we can generate clonmapper.gtf and clonmapper.fa by default in ./references:

clongen --lineages ./lineages.csv

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

clongen-2023.1001.tar.gz (4.3 kB view details)

Uploaded Source

Built Distribution

If you're not sure about the file name format, learn more about wheel file names.

clongen-2023.1001-py3-none-any.whl (5.6 kB view details)

Uploaded Python 3

File details

Details for the file clongen-2023.1001.tar.gz.

File metadata

  • Download URL: clongen-2023.1001.tar.gz
  • Upload date:
  • Size: 4.3 kB
  • Tags: Source
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/4.0.2 CPython/3.8.10

File hashes

Hashes for clongen-2023.1001.tar.gz
Algorithm Hash digest
SHA256 99950685b9a7e4ec11dbb3d5f02177075fe78f714745c84e880bcc67325e5397
MD5 4770d012dbf587330b118aafe1ecc4ea
BLAKE2b-256 a166158d7f2f231149a6fd90af5afc9c181e7384e24c1a09c51d53f12c4b3d78

See more details on using hashes here.

File details

Details for the file clongen-2023.1001-py3-none-any.whl.

File metadata

  • Download URL: clongen-2023.1001-py3-none-any.whl
  • Upload date:
  • Size: 5.6 kB
  • Tags: Python 3
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/4.0.2 CPython/3.8.10

File hashes

Hashes for clongen-2023.1001-py3-none-any.whl
Algorithm Hash digest
SHA256 adbf6cd35ef9b64f66468af85e1d563282ccac45eeae756655f1c2707347b89e
MD5 52c5ada5faac990e2b80d4275ec6e70a
BLAKE2b-256 7407e77cb521aad161c9516a32f2258016952e64ca485ed3c70587b1dc53c39e

See more details on using hashes here.

Supported by

AWS Cloud computing and Security Sponsor Datadog Monitoring Depot Continuous Integration Fastly CDN Google Download Analytics Pingdom Monitoring Sentry Error logging StatusPage Status page