Clongen: ClonMapper Reference Generator

Installation

pipx install clongen 
python3 <(curl -fsSL viv.dayl.in/viv.py) shim clongen

For one-time use consider using viv run to use an ephemeral venv, see below for an example.

NOTE: make sure to separate viv and clongen flags with --

python3 <(curl -fsSL viv.dayl.in/viv.py) run \
  clongen -- --lineages ./lineages.csv

Usage

To generate a clonmapper-compatible reference genome we first need to produce a fasta and gtf file of our expected lineages. This is where clongen comes in. The only input is a single csv that can come in one of two forms.

id,lineage
lineage1,ATGATCATGGTACCATAAGG
...

You may also provide a simpler version with only lineage sequences:

ATGATCATGGTACCATAAGG
...

The header is optional, however we will only attempt to match with id,lineage or lineage. Any other header will likely not be removed and assumed to be a lineage and id.

If the input list contains id's these will be used as the gene_name. Otherwise we will use the full lineage sequence proceeded by the prefix designated by prefix flag, by default "lin-".

Then we can generate clonmapper.gtf and clonmapper.fa by default in ./references:

clongen --lineages ./lineages.csv