crispr-da 1.0.0

Adapting CRISPR gRNA design for detection assays.

CRISPR-DA

Adapting CRISPR gRNA design for detection assays.

Preamble

CRISPR-Cas systems offer a viable alternative to traditional detection and diagnosis methods. However, their effectiveness relies heavily on the selection of appropriate guide RNA sequences. Existing gRNA design tools were primarily developed for gene editing and are not always directly applicable to CRISPR-based detection assays. In particular, alignment-based methods are still used to estimate gRNA specificity, even though they can miss a substantial portion of off-target sites. In this work, we introduce CRISPR-DA, a CRISPR gRNA design tool for detection assays. We show that it provides a better assessment of gRNA specificity than BLAST, which detected only 33.27 % and 0.43 % of cross-species off-targets in two datasets. Additionally, CRISPR-DA ran two and six times faster than BLAST on these datasets, respectively. Our method incorporates advances from gene-editing guide RNA design tools, including uncertainty-informed guide RNA design, to improve the selection of guides with high on-target activity. CRISPR-DA is available at https://github.com/bmds-lab/CRISPR-DA.

Licence

BSD 3-Clause "New" or "Revised" License

See LICENCE and https://opensource.org/license/BSD-3-Clause for more details.

Dependencies

Option 1. Using Anaconda (Recommended)

1. Download the environment.yml file from GitHub.

2. Download and install Anaconda.

3. Setup conda enviroment.

   conda env create -f <path/to/downloaded/environment.yml>
   

Option 2. Install dependencies manually

1. Download and install the following (The software/program version provided were using during testing but there "should" be no problem using newer version).

• Python>=3.12
• CMake>=4.1.2
• Boost>=1.82
• Make>=4.2.1 NOTE: You can replace Make with whichever build system you like (E.g. Ninja).

Installation

From PyPi using pip (Recommended)

1. Install using pip.

   pip install crispr-da
   

2. Run config to install required binaries and initialise configuration file.

   crispr_da config
   

From source

1. Clone the repository from GitHub.

   git clone https://github.com/bmds-lab/CRISPR-DA
   

2. Build distribution files.

   python3 -m build
   

   NOTE: It may be useful to ensure the latest version of PyPA's build is install. Simply run python3 -m pip install --upgrade build.

3. Install CRISPR-DA using distribution files and pip.

   python3 -m pip install ./dist/*.whl
   

4. Run config to install required binaries and initialise configuration file.

   crispr_da config
   

CRISPR-DA CLI

Usage

$ crispr_da -h
usage: crispr_da [-h] [-v] {config,analyse} ...

CRISPR-DA: gRNA design for detection assays.

options:
-h, --help        show this help message and exit
-v, --version     Print CRISPR-DA version

subcommands:
{config,analyse}
   config          Run config
   analyse         Run analysis

Example

$ crispr_da analyse --target_gene_id 43740568 --evaluation_accessions GCA_000820495.2 GCA_000838265.1

Expected output format (minimised for this readme):

accession	TACACTAATTCTTTCACACGTGG	...	CTTTCTTTTCCAATGTTACTTGG
GCA_000820495.2	(100.0, 100.0)	...	(100.0, 100.0)
GCA_000838265.1	(100.0, 100.0)	...	(100.0, 100.0)

CRISPR-DA Python Library

Usage

CRISPR-DA can also be access using Python.

from crispr_da import run_analysis

Example

An minimal example has been included in the examples/design_for_covid_spike_protein.py