Skip to main content

A packagees into DNA, RNA or protein sequences.

Project description

crockode

crockode is a python package for encoding a string message into a DNA sequence and decoding .

Installation

$ pip install crockode

Usage

import crockode

# returns 'GCCAGCGGGCTAGCTAGCTT'
crockode.encode_string('hello')

# returns 'hello'
crockode.decode_DNA('GCCAGCGGGCTAGCTAGCTT')

Contributing

Interested in contributing? Check out the contributing guidelines. Please note that this project is released with a Code of Conduct. By contributing to this project, you agree to abide by its terms.

License

crockode was created by Michela Palamin, Simone Procaccia, Erin Chung, Joshua Talks. It is licensed under the terms of the MIT license.

Credits

crockode was created with cookiecutter and the py-pkgs-cookiecutter template.

Project status

The creators have run out of time, energy, and motivation to develop this project. Rest In Peace crockode 05/02/2024-09/02/2024.

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

crockode-0.1.1.tar.gz (2.9 kB view details)

Uploaded Source

Built Distribution

If you're not sure about the file name format, learn more about wheel file names.

crockode-0.1.1-py3-none-any.whl (3.7 kB view details)

Uploaded Python 3

File details

Details for the file crockode-0.1.1.tar.gz.

File metadata

  • Download URL: crockode-0.1.1.tar.gz
  • Upload date:
  • Size: 2.9 kB
  • Tags: Source
  • Uploaded using Trusted Publishing? No
  • Uploaded via: poetry/1.7.1 CPython/3.11.5 Linux/6.2.0-1018-aws

File hashes

Hashes for crockode-0.1.1.tar.gz
Algorithm Hash digest
SHA256 a8dca2eb1847b4fa2592637d6856c3f3d55284a54650ea4436e0ef68a8406c84
MD5 b2ccf761d8bf740b6ac09491b3f80ae9
BLAKE2b-256 2ca7c10268de4b516a9c8c467566a4820971ed9d925ac3c73222ba1afa885938

See more details on using hashes here.

File details

Details for the file crockode-0.1.1-py3-none-any.whl.

File metadata

  • Download URL: crockode-0.1.1-py3-none-any.whl
  • Upload date:
  • Size: 3.7 kB
  • Tags: Python 3
  • Uploaded using Trusted Publishing? No
  • Uploaded via: poetry/1.7.1 CPython/3.11.5 Linux/6.2.0-1018-aws

File hashes

Hashes for crockode-0.1.1-py3-none-any.whl
Algorithm Hash digest
SHA256 f1f5774593bf3c7e57629b61fe0943ba3aaa8ea90b490205cbe2fcc47d016b8d
MD5 a222675ad95fe2eefe73089b0d37be4d
BLAKE2b-256 7eeef3c63d3e676d8a71a573c8bae97478c8727b6b45add0a2ca0587f1d9c238

See more details on using hashes here.

Supported by

AWS Cloud computing and Security Sponsor Datadog Monitoring Depot Continuous Integration Fastly CDN Google Download Analytics Pingdom Monitoring Sentry Error logging StatusPage Status page