Skip to main content

Encode and decode strings to DNA

Project description

DDNA

Program / Library that converts sentences to DNA sequence and vice-versa.

Pylint pytest

O       o O       o O       o
A O   o | A O   o | | O   o G
| G O | C 1 | O G | T | O | 1
1 o   O | T o   O A | o   O C
o       O o       O o       O

Installation:

pip install ddna

Usage:

  • program
 python3 -m ddna -h    
usage: ddna.py [-h] [-e ENCODE] [-d DECODE]

DDNA - DNA Encoder/Decoder

optional arguments:
  -h, --help            show this help message and exit
  -e ENCODE, --encode ENCODE
                        Encode String to DNA
  -d DECODE, --decode DECODE
                        Decode DNA to String
  • pip package
>>> from ddna import DDNA
>>> DDNA().encode("HELLO WORLD")
'CAGACACCCATACATACATTAGAACCCTCATTCCAGCATACACA'
>>> DDNA().decode("CAGACACCCATACATACATTAGAACCCTCATTCCAGCATACACA")
'HELLO WORLD'

Plans:

  • Introduce Mutations
  • Introduce new form of encryption based on mutations

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

ddna-0.1.2.tar.gz (4.6 kB view details)

Uploaded Source

Built Distribution

If you're not sure about the file name format, learn more about wheel file names.

ddna-0.1.2-py3-none-any.whl (5.6 kB view details)

Uploaded Python 3

File details

Details for the file ddna-0.1.2.tar.gz.

File metadata

  • Download URL: ddna-0.1.2.tar.gz
  • Upload date:
  • Size: 4.6 kB
  • Tags: Source
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/3.7.1 importlib_metadata/4.10.1 pkginfo/1.8.2 requests/2.27.1 requests-toolbelt/0.9.1 tqdm/4.62.3 CPython/3.9.10

File hashes

Hashes for ddna-0.1.2.tar.gz
Algorithm Hash digest
SHA256 8ece2b2a297e255eb059246aacd23eeaaff23c6f4de1e1f7b42b0c123e3cef1a
MD5 1ad95148a4731bfead990c20b4c9fefa
BLAKE2b-256 c9ec49d5a8e6710cafe6affd3d38ab80b17881292b44d90ff876c8e0c3392102

See more details on using hashes here.

File details

Details for the file ddna-0.1.2-py3-none-any.whl.

File metadata

  • Download URL: ddna-0.1.2-py3-none-any.whl
  • Upload date:
  • Size: 5.6 kB
  • Tags: Python 3
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/3.7.1 importlib_metadata/4.10.1 pkginfo/1.8.2 requests/2.27.1 requests-toolbelt/0.9.1 tqdm/4.62.3 CPython/3.9.10

File hashes

Hashes for ddna-0.1.2-py3-none-any.whl
Algorithm Hash digest
SHA256 61cac015cf6619167370d8ac096c649ff10fb6c3f7a4ea99daa89cbe2a195793
MD5 3d9fd67ac3169eeea52623f4826c6526
BLAKE2b-256 f72290df0004b81e4b03cf1232e13e5e91ba3065ff558f579500d8a715c49dc4

See more details on using hashes here.

Supported by

AWS Cloud computing and Security Sponsor Datadog Monitoring Depot Continuous Integration Fastly CDN Google Download Analytics Pingdom Monitoring Sentry Error logging StatusPage Status page