dna-ibp 1.2.0

Command-line tool for DNA sequence analysis and processing

DNA IBP Command Line Interface

CLI application for the DNA analyser IBP API wrapper (https://github.com/patrikkaura/dna-analyser-ibp)

Installation requirements

• Python v.3.10 or better
• pip

Installation guide

Run the following command in your command line

pip install dna-ibp

Getting started

Upon entering any command prefaced by dna-ibp, the user is prompted to enter their DNA analyser (https://bioinformatics.ibp.cz/) credentials.

C:\Users\kryst>dna-ibp sequence show all
Enter your email        [e-mail]
Enter your password
2025-07-31 13:03:51.383532 [INFO]: User [e-mail] is trying to login ...
2025-07-31 13:03:51.612553 [INFO]: User [e-mail] is successfully loged in ...

This login session lasts for 60 minutes or can be disconnected prematurely by using the --reset/-r command:

C:\Users\kryst>dna-ibp --reset
2025-07-31 13:07:26.229684 [INFO]: User [e-mail] logged out...

The --help/-h command can be used after any previous command to list possible sub-commands or arguments:

C:\Users\kryst>dna-ibp --help
usage: dna-ibp [-h] [--version] [--reset] {sequence,g4hunter,rloop,zdna,cpx,g4killer,p53} ...

positional arguments:
  {sequence,g4hunter,rloop,zdna,cpx,g4killer,p53}
    sequence            Parser for sequence related operations.
    g4hunter            Parser for methods of the G4Hunter tool.
    rloop               Parser for methods of the R-loop tracker tool.
    zdna                Parser for methods of the Z-DNA hunter tool.
    cpx                 Parser for methods of the CpX hunter tool.
    g4killer            Parser for methods of the G4Killer tool.
    p53                 Parser for methods of the P53 predictor tool.

options:
  -h, --help            show this help message and exit
  --version, -v         show program's version number and exit
  --reset, -r

Usage examples

• User wants to upload a sequence with NCBI ID NC_010000, name Shewanella baltica and tags SMALL and PLASM:

C:\Users\kryst>dna-ibp sequence create --id NC_010000 --name "Shewanella baltica" --tags SMALL PLASM

---

• User wants to analyse all uploaded sequences using the R-loop tracker tool, with default parameters:

C:\Users\kryst>dna-ibp rloop analyse all

---

• User wants to display the latest G4Hunter analysis result:

C:\Users\kryst>dna-ibp g4hunter show -1

---

• User wants to export all Z-DNA hunter analysis results on their account to a .csv file to the current working directory:

C:\Users\kryst>dna-ibp zdna export all --path ./

---

• User wants to delete a CpX analysis result with the ID: 7c6e6d56-da6e-4355-bcc8-5601465d646e:

C:\Users\kryst>dna-ibp cpx delete 7c6e6d56-da6e-4355-bcc8-5601465d646e

---

• User wants to analyse a sequence GGACATGCCCGGGCATGGGG using G4Killer tool (with complementary sequence setting turned OFF):

C:\Users\kryst>dna-ibp g4killer run GGACATGCCCGGGCATGTCC --no-comp

Documentation

To see all valid commands see the full list of CLI commands.

Dependencies

DNA_analyser_IBP >=3.7.1

Authors

• Kryštof Kotrys - Main Developer - krystofkotrys

License

This project is licensed under the GPL-3.0 License - see the LICENSE.md file for details.