Skip to main content

DNA: A domain-specific language (transcription between UTF-8 and binary) based on YAML.

Project description

logo

DNA

GitHub Actions Workflow Status GitHub last commit PyPI - Python Version PyPI - Version PyPI - Wheel PyPI - Downloads GitHub License

Installation

DNA can be installed from PyPI:

pip install dnadsl

or download the repository and run:

pip install .

as of the repository root folder.

Examples

  • The input YAML file:

    text_utf8: ❤️🐶
    
  • The output YAML file:

    text_utf8: ❤️🐶
    dna:
    positive_strand:
        sequence: TGAGGCTCGGCATGTTGTGAGATTTTAAGCTTGCAAGTCG
        binary: 11100010 10011101 10100100 11101111 10111000 10001111 11110000 10011111
        10010000 10110110
        text: ❤️🐶
    negative_strand:
        sequence: ACTCCGAGCCGTACAACACTCTAAAATTCGAACGTTCAGC
        binary: 00011101 01100010 01011011 00010000 01000111 01110000 00001111 01100000
        01101111 01001001
        text: "\x1Db[\x10Gp\x0F`oI"
    

Packaging

The binaries are created with PyInstaller:

# Package it on Linux
pyinstaller --name DNA --onefile -p dna dna/__main__.py

# Package it on Windows
pyinstaller --name DNA --onefile --icon python.ico -p dna dna/__main__.py

Copyrights

DNA is a free, open-source software package (distributed under the GPLv3 license). The logo used in README.md is downloaded from Wikimedia Commons. The Python icon is downloaded from python.ico.

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

dnadsl-0.1.0.tar.gz (16.7 kB view details)

Uploaded Source

Built Distribution

If you're not sure about the file name format, learn more about wheel file names.

dnadsl-0.1.0-py3-none-any.whl (18.0 kB view details)

Uploaded Python 3

File details

Details for the file dnadsl-0.1.0.tar.gz.

File metadata

  • Download URL: dnadsl-0.1.0.tar.gz
  • Upload date:
  • Size: 16.7 kB
  • Tags: Source
  • Uploaded using Trusted Publishing? Yes
  • Uploaded via: twine/6.1.0 CPython/3.13.7

File hashes

Hashes for dnadsl-0.1.0.tar.gz
Algorithm Hash digest
SHA256 14dc7dd3c59586bcf5d393aea2b8f15539978b8b45d9bb3887dc03e8dec53266
MD5 96de9a87efde37c10d004c4590696582
BLAKE2b-256 b106ddc312df10dfd96f5dfc598bbaee7cca9433ea4a08dfda22651d40c78366

See more details on using hashes here.

Provenance

The following attestation bundles were made for dnadsl-0.1.0.tar.gz:

Publisher: python-publish.yml on project-aico/dna

Attestations: Values shown here reflect the state when the release was signed and may no longer be current.

File details

Details for the file dnadsl-0.1.0-py3-none-any.whl.

File metadata

  • Download URL: dnadsl-0.1.0-py3-none-any.whl
  • Upload date:
  • Size: 18.0 kB
  • Tags: Python 3
  • Uploaded using Trusted Publishing? Yes
  • Uploaded via: twine/6.1.0 CPython/3.13.7

File hashes

Hashes for dnadsl-0.1.0-py3-none-any.whl
Algorithm Hash digest
SHA256 993ba0da63314f6c939ba2e1f5a27056a49482ecb6adc7c982dcbdd798b978eb
MD5 5c87d0cd48f5e8d244eb125f03c88461
BLAKE2b-256 42e841573e922a8f8f9ed35eabb1303e6c06d2c2fdd42cb000a6660bcd881d44

See more details on using hashes here.

Provenance

The following attestation bundles were made for dnadsl-0.1.0-py3-none-any.whl:

Publisher: python-publish.yml on project-aico/dna

Attestations: Values shown here reflect the state when the release was signed and may no longer be current.

Supported by

AWS Cloud computing and Security Sponsor Datadog Monitoring Depot Continuous Integration Fastly CDN Google Download Analytics Pingdom Monitoring Sentry Error logging StatusPage Status page