edentity 1.4.3

A Snakemake-based pipeline for amplicon processing

edentity-metabarcoding-pipeline

Table of Contents

• Brief on Vsearch
• Usage of this workflow
  • Using Conda
    • Install Requirements
      • Install conda or miniconda
      • Steps to run edentity-metabarcoding-pipeline
  • Using Docker
    • Install Requirements
  • Deploying to Galaxy
    • Prerequisites
    • Steps to Deploy

Brief on Vsearch

Vsearch is a metabarcoding pipeline for illumina/AVITI paired-end data. More details can be found at vsearch github

Vsearch publication: https://doi.org/10.7717/peerj.2584

Technical implementation of this pipeline is inspired by APSCALE; please cite them if you use this pipeline.

Usage of this workflow

This workflow can run on:

- Conda

- Docker 

- Galaxy

Using Conda

Install Requirements

Install conda or miniconda

Ensure (mini)conda is installed on your system. Information on installing miniconda can be found here

Steps to run edentity-metabarcoding-pipeline

1 Clone this repo

git clone https://gitlab.com/naturalis/bii/bioinformatics/edentity/pipelines/edentity-metabarcoding-pipeline.git && cd edentity-metabarcoding-pipeline/

2 Install snakemake conda environment from yaml file

conda env create -n snakemake -f workflow/envs/snakemake.yaml

3 Activate snakemake conda environment

conda activate snakemake

4 Run the workflow: parameters used here are only for example; replace them with params specific to your project.

snakemake -p --profile workflow/profile/ \
    --config forward_primer=AAACTCGTGCCAGCCACC \
    reverse_primer=GGGTATCTAATCCCAGTTTG \
    raw_data_dir=/path/to/your/raw_data/ \
    work_dir=/path/to/your/work_directory \
    min_length=200 max_length=600 

Explain parameters and where more info can be found. Link to validation schema.

Using Docker

Install Requirements

1. Apptainer:

Install apptainer

2. Run the workflow:

snakemake -p --profile workflow/profile/ \
    --config forward_primer=AAACTCGTGCCAGCCACC \
    reverse_primer=GGGTATCTAATCCCAGTTTG \
    raw_data_dir=/path/to/your/raw_data/ \
    work_dir=/path/to/your/work_directory \
    min_length=200 max_length=600 --use-apptainer

Deploying to Galaxy

Prerequisites

Ensure you have access to a Galaxy instance where you have administrative privileges or the ability to install tools and workflows.

Steps to Deploy

1. Clone the Galaxy branch of this repository

Clone galaxy branch of this pipeline into your Galaxy tools directory (for Naturalis clone into: /data/galaxy/local_tools/)

git clone -b galaxy [e-mail]:naturalis/bii/bioinformatics/edentity/pipelines/edentity-metabarcoding-pipeline.git

2. Configure Galaxy tools xml

Edit your Galaxy tool configuration xml file to include the edentity-galaxy-pipeline.xml file located at the root directory of this repository.

For example to add this pipeline to your galaxy instance: Open galaxy/config/tool_config.xml and add the lines below.

<section id="metabarcoding-pipeline" name="Metabarcoding Pipelines">
    <tool file="edentity-metabarcoding-pipeline/edentity-galaxy-pipeline.xml"/>
</section>

NB:

• Ensure you paste the above lines within <toolbox> </toolbox> section in the galaxy/config/tool_config.xml
• Ensure paths are correctly referenced depending on where you cloned the pipeline
• Some useful tips on adding custom tools on galaxy can be found here

3. Restart Galaxy

Restart your Galaxy instance to load the new tool configuration.

4. Running the pipeline on Galaxy:

Example on how to run this pipeline on Galaxy is available here