Skip to main content

A library to build our DMS signal and RNAstructure prediction models.

Project description

eFold

This repo contains the pytorch code for our paper “Diverse Database and Machine Learning Model to narrow the generalization gap in RNA structure prediction”

[BioRXiv] [Data]

Install

pip install efold

Inference mode

Using the command line

From a sequence:

efold AAACAUGAGGAUUACCCAUGU -o seq.txt
cat seq.txt

AAACAUGAGGAUUACCCAUGU
..(((((.((....)))))))

or a fasta file:

efold --fasta example.fasta

Using different formats:

efold AAACAUGAGGAUUACCCAUGU -bp # base pairs
efold AAACAUGAGGAUUACCCAUGU -db # dotbracket (default)

Output can be .json, .csv or .txt

efold AAACAUGAGGAUUACCCAUGU -o output.csv

Run help:

efold -h

Using python

>>> from efold import inference
>>> inference('AACUGUGCUA', fmt='dotbracket')
..(((((.((....)))))))

File structure

efold/
    api/    # for inference calls
    core/   # backend 
    models/ # where we define eFold and other models
    resources/
        efold_weights.py # our best model weights
scripts/
    efold_training.py # our training script
    [...]
LICENSE
requirements.txt
pyproject.toml

Data

List of the datasets we used

A breakdown of the data we used is summarized here. All the data is stored on the HuggingFace.

Get the data

You can download our datasets using rouskinHF:

pip install rouskinhf

And in your code, write:

>>> import rouskinhf
>>> data = rouskinhf.get_dataset('ribo500-blast') # look at the dataset names on huggingface

Reproducing our results

Run the training script:

git clone https://github.com/rouskinlab/eFold
python eFold/scripts/efold_training.py

Citation

Plain text:

Albéric A. de Lajarte, Yves J. Martin des Taillades, Colin Kalicki, Federico Fuchs Wightman, Justin Aruda, Dragui Salazar, Matthew F. Allan, Casper L’Esperance-Kerckhoff, Alex Kashi, Fabrice Jossinet, Silvi Rouskin. “Diverse Database and Machine Learning Model to narrow the generalization gap in RNA structure prediction”. bioRxiv 2024.01.24.577093; doi: https://doi.org/10.1101/2024.01.24.577093. 2024

BibTex:

@article {Lajarte_Martin_2024,
	title = {Diverse Database and Machine Learning Model to narrow the generalization gap in RNA structure prediction},
	author = {Alb{\'e}ric A. de Lajarte and Yves J. Martin des Taillades and Colin Kalicki and Federico Fuchs Wightman and Justin Aruda and Dragui Salazar and Matthew F. Allan and Casper L{\textquoteright}Esperance-Kerckhoff and Alex Kashi and Fabrice Jossinet and Silvi Rouskin},
	year = {2024},
	doi = {10.1101/2024.01.24.577093},
	URL = {https://www.biorxiv.org/content/early/2024/01/25/2024.01.24.577093},
	journal = {bioRxiv}
}

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

efold-0.1.2.tar.gz (10.3 MB view details)

Uploaded Source

Built Distribution

If you're not sure about the file name format, learn more about wheel file names.

efold-0.1.2-py3-none-any.whl (10.3 MB view details)

Uploaded Python 3

File details

Details for the file efold-0.1.2.tar.gz.

File metadata

  • Download URL: efold-0.1.2.tar.gz
  • Upload date:
  • Size: 10.3 MB
  • Tags: Source
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/4.0.2 CPython/3.11.6

File hashes

Hashes for efold-0.1.2.tar.gz
Algorithm Hash digest
SHA256 5ef8ddd1d95d0ffffa2e83a0245048303eeb6793f35a9794590707468ead47ff
MD5 92bcedb4932b70a2169813dc254e19d9
BLAKE2b-256 d02c08f7cfc5dd8d88dce40ca5f97122f15625958903cb81af9f7dc8a1d99c5c

See more details on using hashes here.

File details

Details for the file efold-0.1.2-py3-none-any.whl.

File metadata

  • Download URL: efold-0.1.2-py3-none-any.whl
  • Upload date:
  • Size: 10.3 MB
  • Tags: Python 3
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/4.0.2 CPython/3.11.6

File hashes

Hashes for efold-0.1.2-py3-none-any.whl
Algorithm Hash digest
SHA256 f632e6fb3b1b5e7e9016372264961b3c26c6c7e8b9472d431b15b349729fd71b
MD5 cb00d3d11177b3ca9fd98c59b894d3b7
BLAKE2b-256 f47faca700d72a3b9a61a9978510e918faabfc32f4e4bb4e631313a601899524

See more details on using hashes here.

Supported by

AWS Cloud computing and Security Sponsor Datadog Monitoring Depot Continuous Integration Fastly CDN Google Download Analytics Pingdom Monitoring Sentry Error logging StatusPage Status page