Skip to main content

eFold

This repo contains the pytorch code for our paper “Diverse Database and Machine Learning Model to narrow the generalization gap in RNA structure prediction”

[BioRXiv] [Data]

Install

pip install efold

Inference mode

Using the command line

From a sequence:

efold AAACAUGAGGAUUACCCAUGU -o seq.txt
cat seq.txt

AAACAUGAGGAUUACCCAUGU
..(((((.((....)))))))

or a fasta file:

efold --fasta example.fasta

Using different formats:

efold AAACAUGAGGAUUACCCAUGU -bp # base pairs
efold AAACAUGAGGAUUACCCAUGU -db # dotbracket (default)

Output can be .json, .csv or .txt

efold AAACAUGAGGAUUACCCAUGU -o output.csv

Run help:

efold -h

Using python

>>> from efold import inference
>>> inference('AACUGUGCUA', fmt='dotbracket')
..(((((.((....)))))))

File structure

efold/
    api/    # for inference calls
    core/   # backend 
    models/ # where we define eFold and other models
    resources/
        efold_weights.py # our best model weights
scripts/
    efold_training.py # our training script
    [...]
LICENSE
requirements.txt
pyproject.toml

Data

List of the datasets we used

A breakdown of the data we used is summarized here. All the data is stored on the HuggingFace.

Get the data

You can download our datasets using rouskinHF:

pip install rouskinhf

And in your code, write:

>>> import rouskinhf
>>> data = rouskinhf.get_dataset('ribo500-blast') # look at the dataset names on huggingface

Reproducing our results

Run the training script:

git clone https://github.com/rouskinlab/eFold
python eFold/scripts/efold_training.py

Citation

Plain text:

Albéric A. de Lajarte, Yves J. Martin des Taillades, Colin Kalicki, Federico Fuchs Wightman, Justin Aruda, Dragui Salazar, Matthew F. Allan, Casper L’Esperance-Kerckhoff, Alex Kashi, Fabrice Jossinet, Silvi Rouskin. “Diverse Database and Machine Learning Model to narrow the generalization gap in RNA structure prediction”. bioRxiv 2024.01.24.577093; doi: https://doi.org/10.1101/2024.01.24.577093. 2024

BibTex:

@article {Lajarte_Martin_2024,
	title = {Diverse Database and Machine Learning Model to narrow the generalization gap in RNA structure prediction},
	author = {Alb{\'e}ric A. de Lajarte and Yves J. Martin des Taillades and Colin Kalicki and Federico Fuchs Wightman and Justin Aruda and Dragui Salazar and Matthew F. Allan and Casper L{\textquoteright}Esperance-Kerckhoff and Alex Kashi and Fabrice Jossinet and Silvi Rouskin},
	year = {2024},
	doi = {10.1101/2024.01.24.577093},
	URL = {https://www.biorxiv.org/content/early/2024/01/25/2024.01.24.577093},
	journal = {bioRxiv}
}

Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

efold-0.1.2.tar.gz (10.3 MB view details)

Uploaded Source

Built Distribution

If you're not sure about the file name format, learn more about wheel file names.

efold-0.1.2-py3-none-any.whl (10.3 MB view details)

Uploaded Python 3

File details

Details for the file efold-0.1.2.tar.gz.

File metadata

  • Download URL: efold-0.1.2.tar.gz
  • Upload date:
  • Size: 10.3 MB
  • Tags: Source
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/4.0.2 CPython/3.11.6

File hashes

Hashes for efold-0.1.2.tar.gz
Algorithm Hash digest
SHA256 5ef8ddd1d95d0ffffa2e83a0245048303eeb6793f35a9794590707468ead47ff
MD5 92bcedb4932b70a2169813dc254e19d9
BLAKE2b-256 d02c08f7cfc5dd8d88dce40ca5f97122f15625958903cb81af9f7dc8a1d99c5c

See more details on using hashes here.

File details

Details for the file efold-0.1.2-py3-none-any.whl.

File metadata

  • Download URL: efold-0.1.2-py3-none-any.whl
  • Upload date:
  • Size: 10.3 MB
  • Tags: Python 3
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/4.0.2 CPython/3.11.6

File hashes

Hashes for efold-0.1.2-py3-none-any.whl
Algorithm Hash digest
SHA256 f632e6fb3b1b5e7e9016372264961b3c26c6c7e8b9472d431b15b349729fd71b
MD5 cb00d3d11177b3ca9fd98c59b894d3b7
BLAKE2b-256 f47faca700d72a3b9a61a9978510e918faabfc32f4e4bb4e631313a601899524

See more details on using hashes here.

Release history Release notifications | RSS feed

This release

0.1.2 This release

2 files

0.1.1

2 files

0.1.0

2 files

Supported by

AWS Cloud computing and Security Sponsor Datadog Monitoring Depot Continuous Integration Fastly CDN Google Download Analytics Sentry Error logging StatusPage Status page