Skip to main content

Find and classify tetrads and quadruplexes in DNA/RNA 3D structure

Project description

Project description

This is an application to analyze base pairing patterns of DNA/RNA 3D structures to find and classify tetrads and quadruplexes. ElTetrado assigns tetrads to one of the ONZ classes (O, N, Z) alongside with the directionality of the tetrad (+/-) determined by the bonds between bases and their non-canonical interactions. The interactions follow Leontis/Westhof classification (Leontis et al. 2001). Watson-Crick (W) edge of first base in the tetrad structure exposed to the Hoogsteen (H) edge of the next nucleobase from the same tetrad sets the tetrad directionality, clockwise (+) or anticlockwise (-). For more details, please refer to Zok et al. (2020) and Popenda et al. (2020)

Installation

Please run:

pip install eltetrado

If you have both Python 2 and Python 3 installed, you need to explicitly call pip3:

pip3 install eltetrado

Dependencies

The project is written in Python 3.6+ and requires mmcif, orjson, NumPy and requests.

Visualization is created by R 3.6+ script which uses R4RNA (Lai et al. 2012) library. The dependency will be automatically installed if not present.

Base pairs and stacking interactions are identified by RNApolis.

Usage

ElTetrado is a command line application, which requires to be provided with --input and a path to a PDB or PDBx/mmCIF file.

By default, ElTetrado outputs textual results on the standard output. A JSON version of the output can be obtained with --output switch followed by a path where the file is supposed to be created.

ElTetrado prepares visualization of the whole structure and of each N4-helices, quadruplexes and tetrads. This can be supplemented with canonical base pairs visualization when --complete-2d is set. All color settings are located in the first several lines of the quadraw.R file, you can easily change them without knowledge of R language. If you want ElTetrado to not visualize anything, pass --no-image switch to it.

usage: eltetrado [-h] [-i INPUT] [-o OUTPUT] [-m MODEL] [--no-reorder]
                 [--complete-2d] [--image DIR] [-e [EXTERNAL_FILES ...]]
                 [--tool {fr3d,dssr,rnaview,bpnet,maxit}] [-v]

options:
  -h, --help            show this help message and exit
  -i INPUT, --input INPUT
                        path to input PDB or PDBx/mmCIF file
  -o OUTPUT, --output OUTPUT
                        (optional) path for output JSON file
  -m MODEL, --model MODEL
                        (optional) model number to process
  --no-reorder          chains of bi- and tetramolecular quadruplexes should
                        be reordered to be able to have them classified; when
                        this is set, chains will be processed in original
                        order, which for bi-/tetramolecular means that they
                        will likely be misclassified; use with care!
  --complete-2d         when set, the visualization will also show canonical
                        base pairs to provide context for the quadruplex
  --image DIR           directory where visualization files (PDF) will be
                        saved; if omitted, no images are generated
  -e [EXTERNAL_FILES ...], --external-files [EXTERNAL_FILES ...]
                        path(s) to external tool output file(s); if omitted
                        ElTetrado will compute interactions itself
  --tool {fr3d,dssr,rnaview,bpnet,maxit}
                        name of the external tool that produced the files
                        (auto-detected when not provided)
  -v, --version         show program's version number and exit

Chains reorder

ElTetrado keeps a global and unique 5’-3’ index for every nucleotide which is independent from residue numbers. For example, if a structure has chain M with 60 nucleotides and chain N with 15 nucleotides, then ElTetrado will keep index between 0 and 74 which uniquely identifies every nucleotide. Initially, ElTetrado assigns this indices according to the order of chains in the input file. Therefore, if M preceded N then nucleotides in M will be indexed from 0 to 59 and in N from 60 to 74. Otherwise, nucleotides in N will be indexed from 0 to 14 and in M from 15 to 74.

When --no-reorder is present, this initial assignment is used. Otherwise, ElTetrado exhaustively checks all permutations of chains’ orders. Every permutation check induces recalculation of the global and unique 5’-3’ index and in effect it changes ONZ classification of tetrads.

ElTetrado keeps a table of tetrad classification scores according to these rules:

  • Type preference: O > N > Z
  • Direction preference: + > -

The table keeps low values for preferred classes i.e. O+ is 0, O- is 1 and so on up to Z- with score 5. For every permutation of chain orders, ElTetrado computes sum of scores for tetrads classification induced by 5’-3’ indexing. We select permutation with the minimum value.

Examples

2HY9: Human telomere DNA quadruplex structure in K+ solution hybrid-1 form

$ curl ftp://ftp.wwpdb.org/pub/pdb/data/structures/divided/mmCIF/my/2hy9.cif.gz | gzip -d > 2hy9.cif
$ ./eltetrado --input 2hy9.cif --output 2hy9.json

Chain order: 1
n4-helix with 3 tetrads
  Oh* V 9a -(pll) quadruplex with 3 tetrads
    1.DG4 1.DG22 1.DG18 1.DG10 cWH cWH cWH cWH O- Vb planarity=0.17  
      direction=hybrid rise=3.21 twist=16.23
    1.DG5 1.DG23 1.DG17 1.DG11 cHW cHW cHW cHW O+ Va planarity=0.1  
      direction=hybrid rise=3.11 twist=27.45
    1.DG6 1.DG24 1.DG16 1.DG12 cHW cHW cHW cHW O+ Va planarity=0.18  

    Tracts:
      1.DG4, 1.DG5, 1.DG6
      1.DG22, 1.DG23, 1.DG24
      1.DG18, 1.DG17, 1.DG16
      1.DG10, 1.DG11, 1.DG12

    Loops:
      propeller- 1.DT7, 1.DT8, 1.DA9
      lateral- 1.DT13, 1.DT14, 1.DA15
      lateral+ 1.DT19, 1.DT20, 1.DA21

AAAGGGTTAGGGTTAGGGTTAGGGAA
...(([...{)]...[[}...)]]..
...([{...)((...))(...)]}..

Click to see the output JSON

{
  "metals": [],
  "nucleotides": [
    {
      "index": 1,
      "chain": "1",
      "number": 1,
      "icode": null,
      "molecule": "DNA",
      "fullName": "1.DA1",
      "shortName": "A",
      "chi": 22.30828283085781,
      "glycosidicBond": "syn"
    },
    {
      "index": 2,
      "chain": "1",
      "number": 2,
      "icode": null,
      "molecule": "DNA",
      "fullName": "1.DA2",
      "shortName": "A",
      "chi": -123.05454402191421,
      "glycosidicBond": "anti"
    },
    {
      "index": 3,
      "chain": "1",
      "number": 3,
      "icode": null,
      "molecule": "DNA",
      "fullName": "1.DA3",
      "shortName": "A",
      "chi": -94.96579955603106,
      "glycosidicBond": "anti"
    },
    {
      "index": 4,
      "chain": "1",
      "number": 4,
      "icode": null,
      "molecule": "DNA",
      "fullName": "1.DG4",
      "shortName": "G",
      "chi": 79.28363721639316,
      "glycosidicBond": "syn"
    },
    {
      "index": 5,
      "chain": "1",
      "number": 5,
      "icode": null,
      "molecule": "DNA",
      "fullName": "1.DG5",
      "shortName": "G",
      "chi": -126.01709201555563,
      "glycosidicBond": "anti"
    },
    {
      "index": 6,
      "chain": "1",
      "number": 6,
      "icode": null,
      "molecule": "DNA",
      "fullName": "1.DG6",
      "shortName": "G",
      "chi": -127.26656202302102,
      "glycosidicBond": "anti"
    },
    {
      "index": 7,
      "chain": "1",
      "number": 7,
      "icode": null,
      "molecule": "DNA",
      "fullName": "1.DT7",
      "shortName": "T",
      "chi": -63.10830751967371,
      "glycosidicBond": "anti"
    },
    {
      "index": 8,
      "chain": "1",
      "number": 8,
      "icode": null,
      "molecule": "DNA",
      "fullName": "1.DT8",
      "shortName": "T",
      "chi": -138.79520345559828,
      "glycosidicBond": "anti"
    },
    {
      "index": 9,
      "chain": "1",
      "number": 9,
      "icode": null,
      "molecule": "DNA",
      "fullName": "1.DA9",
      "shortName": "A",
      "chi": -148.83990757408878,
      "glycosidicBond": "anti"
    },
    {
      "index": 10,
      "chain": "1",
      "number": 10,
      "icode": null,
      "molecule": "DNA",
      "fullName": "1.DG10",
      "shortName": "G",
      "chi": 58.77875250191579,
      "glycosidicBond": "syn"
    },
    {
      "index": 11,
      "chain": "1",
      "number": 11,
      "icode": null,
      "molecule": "DNA",
      "fullName": "1.DG11",
      "shortName": "G",
      "chi": -123.85746807924986,
      "glycosidicBond": "anti"
    },
    {
      "index": 12,
      "chain": "1",
      "number": 12,
      "icode": null,
      "molecule": "DNA",
      "fullName": "1.DG12",
      "shortName": "G",
      "chi": -84.36679807284759,
      "glycosidicBond": "anti"
    },
    {
      "index": 13,
      "chain": "1",
      "number": 13,
      "icode": null,
      "molecule": "DNA",
      "fullName": "1.DT13",
      "shortName": "T",
      "chi": -30.819029132834157,
      "glycosidicBond": "anti"
    },
    {
      "index": 14,
      "chain": "1",
      "number": 14,
      "icode": null,
      "molecule": "DNA",
      "fullName": "1.DT14",
      "shortName": "T",
      "chi": -168.51776782812965,
      "glycosidicBond": "anti"
    },
    {
      "index": 15,
      "chain": "1",
      "number": 15,
      "icode": null,
      "molecule": "DNA",
      "fullName": "1.DA15",
      "shortName": "A",
      "chi": -105.72881577106517,
      "glycosidicBond": "anti"
    },
    {
      "index": 16,
      "chain": "1",
      "number": 16,
      "icode": null,
      "molecule": "DNA",
      "fullName": "1.DG16",
      "shortName": "G",
      "chi": 74.3227942181243,
      "glycosidicBond": "syn"
    },
    {
      "index": 17,
      "chain": "1",
      "number": 17,
      "icode": null,
      "molecule": "DNA",
      "fullName": "1.DG17",
      "shortName": "G",
      "chi": 81.08424926936044,
      "glycosidicBond": "syn"
    },
    {
      "index": 18,
      "chain": "1",
      "number": 18,
      "icode": null,
      "molecule": "DNA",
      "fullName": "1.DG18",
      "shortName": "G",
      "chi": -122.90397217111551,
      "glycosidicBond": "anti"
    },
    {
      "index": 19,
      "chain": "1",
      "number": 19,
      "icode": null,
      "molecule": "DNA",
      "fullName": "1.DT19",
      "shortName": "T",
      "chi": -102.98239337113938,
      "glycosidicBond": "anti"
    },
    {
      "index": 20,
      "chain": "1",
      "number": 20,
      "icode": null,
      "molecule": "DNA",
      "fullName": "1.DT20",
      "shortName": "T",
      "chi": -112.15146018497148,
      "glycosidicBond": "anti"
    },
    {
      "index": 21,
      "chain": "1",
      "number": 21,
      "icode": null,
      "molecule": "DNA",
      "fullName": "1.DA21",
      "shortName": "A",
      "chi": -89.07113063649612,
      "glycosidicBond": "anti"
    },
    {
      "index": 22,
      "chain": "1",
      "number": 22,
      "icode": null,
      "molecule": "DNA",
      "fullName": "1.DG22",
      "shortName": "G",
      "chi": 83.44318693001902,
      "glycosidicBond": "syn"
    },
    {
      "index": 23,
      "chain": "1",
      "number": 23,
      "icode": null,
      "molecule": "DNA",
      "fullName": "1.DG23",
      "shortName": "G",
      "chi": -115.41210237198395,
      "glycosidicBond": "anti"
    },
    {
      "index": 24,
      "chain": "1",
      "number": 24,
      "icode": null,
      "molecule": "DNA",
      "fullName": "1.DG24",
      "shortName": "G",
      "chi": -111.14845782593532,
      "glycosidicBond": "anti"
    },
    {
      "index": 25,
      "chain": "1",
      "number": 25,
      "icode": null,
      "molecule": "DNA",
      "fullName": "1.DA25",
      "shortName": "A",
      "chi": -58.323530637551954,
      "glycosidicBond": "anti"
    },
    {
      "index": 26,
      "chain": "1",
      "number": 26,
      "icode": null,
      "molecule": "DNA",
      "fullName": "1.DA26",
      "shortName": "A",
      "chi": -90.84065243137135,
      "glycosidicBond": "anti"
    }
  ],
  "basePairs": [
    {
      "nt1": "1.DA3",
      "nt2": "1.DA21",
      "lw": "cHW",
      "inTetrad": false,
      "canonical": false
    },
    {
      "nt1": "1.DG4",
      "nt2": "1.DG10",
      "lw": "cHW",
      "inTetrad": true,
      "canonical": false
    },
    {
      "nt1": "1.DG4",
      "nt2": "1.DG22",
      "lw": "cWH",
      "inTetrad": true,
      "canonical": false
    },
    {
      "nt1": "1.DG5",
      "nt2": "1.DG11",
      "lw": "cWH",
      "inTetrad": true,
      "canonical": false
    },
    {
      "nt1": "1.DG5",
      "nt2": "1.DG23",
      "lw": "cHW",
      "inTetrad": true,
      "canonical": false
    },
    {
      "nt1": "1.DG6",
      "nt2": "1.DG12",
      "lw": "cWH",
      "inTetrad": true,
      "canonical": false
    },
    {
      "nt1": "1.DG6",
      "nt2": "1.DG24",
      "lw": "cHW",
      "inTetrad": true,
      "canonical": false
    },
    {
      "nt1": "1.DG10",
      "nt2": "1.DG18",
      "lw": "cHW",
      "inTetrad": true,
      "canonical": false
    },
    {
      "nt1": "1.DG11",
      "nt2": "1.DG17",
      "lw": "cWH",
      "inTetrad": true,
      "canonical": false
    },
    {
      "nt1": "1.DG12",
      "nt2": "1.DG16",
      "lw": "cWH",
      "inTetrad": true,
      "canonical": false
    },
    {
      "nt1": "1.DT14",
      "nt2": "1.DA25",
      "lw": "tWW",
      "inTetrad": false,
      "canonical": false
    },
    {
      "nt1": "1.DG16",
      "nt2": "1.DG24",
      "lw": "cWH",
      "inTetrad": true,
      "canonical": false
    },
    {
      "nt1": "1.DG17",
      "nt2": "1.DG23",
      "lw": "cWH",
      "inTetrad": true,
      "canonical": false
    },
    {
      "nt1": "1.DG18",
      "nt2": "1.DG22",
      "lw": "cHW",
      "inTetrad": true,
      "canonical": false
    }
  ],
  "helices": [
    {
      "quadruplexes": [
        {
          "tetrads": [
            {
              "id": "1.DG4-1.DG22-1.DG18-1.DG10",
              "nt1": "1.DG4",
              "nt2": "1.DG22",
              "nt3": "1.DG18",
              "nt4": "1.DG10",
              "onz": "O-",
              "gbaClassification": "Vb",
              "planarityDeviation": 0.17372283960377805,
              "ionsChannel": [],
              "ionsOutside": []
            },
            {
              "id": "1.DG5-1.DG23-1.DG17-1.DG11",
              "nt1": "1.DG5",
              "nt2": "1.DG23",
              "nt3": "1.DG17",
              "nt4": "1.DG11",
              "onz": "O+",
              "gbaClassification": "Va",
              "planarityDeviation": 0.10474313820007483,
              "ionsChannel": [],
              "ionsOutside": []
            },
            {
              "id": "1.DG6-1.DG24-1.DG16-1.DG12",
              "nt1": "1.DG6",
              "nt2": "1.DG24",
              "nt3": "1.DG16",
              "nt4": "1.DG12",
              "onz": "O+",
              "gbaClassification": "Va",
              "planarityDeviation": 0.18293509778060615,
              "ionsChannel": [],
              "ionsOutside": []
            }
          ],
          "onzm": "Oh*",
          "loopClassification": {
            "classification": "9a",
            "loopProgression": "-(pll)"
          },
          "gbaClassification": [
            "V"
          ],
          "tracts": [
            [
              "1.DG4",
              "1.DG5",
              "1.DG6"
            ],
            [
              "1.DG22",
              "1.DG23",
              "1.DG24"
            ],
            [
              "1.DG18",
              "1.DG17",
              "1.DG16"
            ],
            [
              "1.DG10",
              "1.DG11",
              "1.DG12"
            ]
          ],
          "bulges": [],
          "loops": [
            {
              "type": "propeller-",
              "nucleotides": [
                "1.DT7",
                "1.DT8",
                "1.DA9"
              ]
            },
            {
              "type": "lateral-",
              "nucleotides": [
                "1.DT13",
                "1.DT14",
                "1.DA15"
              ]
            },
            {
              "type": "lateral+",
              "nucleotides": [
                "1.DT19",
                "1.DT20",
                "1.DA21"
              ]
            }
          ]
        }
      ],
      "tetradPairs": [
        {
          "tetrad1": "1.DG4-1.DG22-1.DG18-1.DG10",
          "tetrad2": "1.DG5-1.DG23-1.DG17-1.DG11",
          "direction": "hybrid",
          "rise": 3.2109650905140654,
          "twist": 16.228973729066034
        },
        {
          "tetrad1": "1.DG5-1.DG23-1.DG17-1.DG11",
          "tetrad2": "1.DG6-1.DG24-1.DG16-1.DG12",
          "direction": "hybrid",
          "rise": 3.1149939255558747,
          "twist": 27.448958336697046
        }
      ]
    }
  ],
  "dotBracket": {
    "sequence": "AAAGGGTTAGGGTTAGGGTTAGGGAA",
    "line1": "...(([...{)]...[[}...)]]..",
    "line2": "...([{...)((...))(...)]}.."
  },
  "quadruplexDotBracket": {
    "sequence": "AAAGGGTTAGGGTTAGGGTTAGGGAA",
    "structure": "...qRS...Qrs...SRq...Qrs..",
    "chi": "saasaaaaasaaaaassaaaasaaaa",
    "loop": "......ppp...lll...LLL....."
  }
}

4RJ1: Structural variations and solvent structure of UGGGGU quadruplexes stabilized by Sr2+ ions

$ curl https://www.ebi.ac.uk/pdbe/static/entry/download/4rj1-assembly-1.cif.gz | gzip -d > 4rj1-1.cif
$ ./eltetrado --input 4rj1-1.cif --output 4rj1-1.json

Chain order: A AB AA AC B BC BA BB
n4-helix with 10 tetrads
  Op* VIII n/a quadruplex with 5 tetrads
    A.U1006 AC.U1006 AA.U1006 AB.U1006 cWH cWH cWH cWH O- VIIIa planarity=1.06  ions_outside=A.U1006: [SR] AA.U1006: [SR] AB.U1006: [SR] AC.U1006: [SR]
      direction=parallel rise=3.37 twist=39.96
    A.G1005 AC.G1005 AA.G1005 AB.G1005 cHW cHW cHW cHW O+ VIIIa planarity=0.8  
      direction=parallel rise=3.31 twist=25.9
    A.G1004 AC.G1004 AA.G1004 AB.G1004 cHW cHW cHW cHW O+ VIIIa planarity=0.41 ions_channel=SR 
      direction=parallel rise=3.34 twist=35.81
    A.G1003 AC.G1003 AA.G1003 AB.G1003 cHW cHW cHW cHW O+ VIIIa planarity=0.55 ions_channel=SR 
      direction=parallel rise=3.29 twist=27.12
    A.G1002 AC.G1002 AA.G1002 AB.G1002 cHW cHW cHW cHW O+ VIIIa planarity=0.54  ions_outside=AB.G1002: [CA] AC.G1002: [CA] AA.G1002: [CA] A.G1002: [CA]

    Tracts:
      A.U1006, A.G1005, A.G1004, A.G1003, A.G1002
      AC.U1006, AC.G1005, AC.G1004, AC.G1003, AC.G1002
      AA.U1006, AA.G1005, AA.G1004, AA.G1003, AA.G1002
      AB.U1006, AB.G1005, AB.G1004, AB.G1003, AB.G1002

  Op* VIII n/a quadruplex with 5 tetrads
    B.G2002 BC.G2002 BA.G2002 BB.G2002 cWH cWH cWH cWH O+ VIIIa planarity=0.67  
      direction=parallel rise=3.37 twist=27.41
    B.G2003 BC.G2003 BA.G2003 BB.G2003 cWH cWH cWH cWH O+ VIIIa planarity=0.58 ions_channel=SR ions_outside=B.G2003: [CA] BA.G2003: [CA] BB.G2003: [CA] BC.G2003: [CA]
      direction=parallel rise=3.32 twist=35.04
    B.G2004 BC.G2004 BA.G2004 BB.G2004 cWH cWH cWH cWH O+ VIIIa planarity=0.23 ions_channel=SR 
      direction=parallel rise=3.27 twist=25.15
    B.G2005 BC.G2005 BA.G2005 BB.G2005 cWH cWH cWH cWH O+ VIIIa planarity=0.78  
      direction=parallel rise=7.14 twist=43.41
    B.U2006 BC.U2006 BA.U2006 BB.U2006 cHW cHW cHW cHW O- VIIIa planarity=1.58 ions_channel=NA,NA 

    Tracts:
      B.G2002, B.G2003, B.G2004, B.G2005, B.U2006
      BC.G2002, BC.G2003, BC.G2004, BC.G2005, BC.U2006
      BA.G2002, BA.G2003, BA.G2004, BA.G2005, BA.U2006
      BB.G2002, BB.G2003, BB.G2004, BB.G2005, BB.U2006

UGGGG-UUGGGG-UUGGGG-UUGGGG-UUGGGG-UUGGGG-UUGGGG-UUGGGGU
.([{<-A.)]}>-(.[{<A-).]}>a-a.([{<-A.)]}>-(.[{<A-).]}>aa
.([{<-(.[{<A-).]}>a-A.)]}>-a.([{<-(.[{<A-).]}>a-A.)]}>a

Click to see the output JSON

{
  "metals": [
    {
      "symbol": "Sr",
      "count": 8
    },
    {
      "symbol": "Na",
      "count": 2
    },
    {
      "symbol": "Ca",
      "count": 8
    }
  ],
  "nucleotides": [
    {
      "index": 1,
      "chain": "A",
      "number": 1001,
      "icode": null,
      "molecule": "RNA",
      "fullName": "A.U1001",
      "shortName": "U",
      "chi": -141.92671313255752,
      "glycosidicBond": "anti"
    },
    {
      "index": 2,
      "chain": "A",
      "number": 1002,
      "icode": null,
      "molecule": "RNA",
      "fullName": "A.G1002",
      "shortName": "G",
      "chi": -165.93034671112116,
      "glycosidicBond": "anti"
    },
    {
      "index": 3,
      "chain": "A",
      "number": 1003,
      "icode": null,
      "molecule": "RNA",
      "fullName": "A.G1003",
      "shortName": "G",
      "chi": -121.5652426033226,
      "glycosidicBond": "anti"
    },
    {
      "index": 4,
      "chain": "A",
      "number": 1004,
      "icode": null,
      "molecule": "RNA",
      "fullName": "A.G1004",
      "shortName": "G",
      "chi": -156.00957673923344,
      "glycosidicBond": "anti"
    },
    {
      "index": 5,
      "chain": "A",
      "number": 1005,
      "icode": null,
      "molecule": "RNA",
      "fullName": "A.G1005",
      "shortName": "G",
      "chi": -148.10051684016415,
      "glycosidicBond": "anti"
    },
    {
      "index": 6,
      "chain": "A",
      "number": 1006,
      "icode": null,
      "molecule": "RNA",
      "fullName": "A.U1006",
      "shortName": "U",
      "chi": -137.28005568139983,
      "glycosidicBond": "anti"
    },
    {
      "index": 13,
      "chain": "AA",
      "number": 1001,
      "icode": null,
      "molecule": "RNA",
      "fullName": "AA.U1001",
      "shortName": "U",
      "chi": -141.9267131325575,
      "glycosidicBond": "anti"
    },
    {
      "index": 14,
      "chain": "AA",
      "number": 1002,
      "icode": null,
      "molecule": "RNA",
      "fullName": "AA.G1002",
      "shortName": "G",
      "chi": -165.93034671112113,
      "glycosidicBond": "anti"
    },
    {
      "index": 15,
      "chain": "AA",
      "number": 1003,
      "icode": null,
      "molecule": "RNA",
      "fullName": "AA.G1003",
      "shortName": "G",
      "chi": -121.56524260332266,
      "glycosidicBond": "anti"
    },
    {
      "index": 16,
      "chain": "AA",
      "number": 1004,
      "icode": null,
      "molecule": "RNA",
      "fullName": "AA.G1004",
      "shortName": "G",
      "chi": -156.0095767392335,
      "glycosidicBond": "anti"
    },
    {
      "index": 17,
      "chain": "AA",
      "number": 1005,
      "icode": null,
      "molecule": "RNA",
      "fullName": "AA.G1005",
      "shortName": "G",
      "chi": -148.10051684016406,
      "glycosidicBond": "anti"
    },
    {
      "index": 18,
      "chain": "AA",
      "number": 1006,
      "icode": null,
      "molecule": "RNA",
      "fullName": "AA.U1006",
      "shortName": "U",
      "chi": -137.2800556813998,
      "glycosidicBond": "anti"
    },
    {
      "index": 7,
      "chain": "AB",
      "number": 1001,
      "icode": null,
      "molecule": "RNA",
      "fullName": "AB.U1001",
      "shortName": "U",
      "chi": -141.92671313255744,
      "glycosidicBond": "anti"
    },
    {
      "index": 8,
      "chain": "AB",
      "number": 1002,
      "icode": null,
      "molecule": "RNA",
      "fullName": "AB.G1002",
      "shortName": "G",
      "chi": -165.93034671112113,
      "glycosidicBond": "anti"
    },
    {
      "index": 9,
      "chain": "AB",
      "number": 1003,
      "icode": null,
      "molecule": "RNA",
      "fullName": "AB.G1003",
      "shortName": "G",
      "chi": -121.56524260332263,
      "glycosidicBond": "anti"
    },
    {
      "index": 10,
      "chain": "AB",
      "number": 1004,
      "icode": null,
      "molecule": "RNA",
      "fullName": "AB.G1004",
      "shortName": "G",
      "chi": -156.00957673923347,
      "glycosidicBond": "anti"
    },
    {
      "index": 11,
      "chain": "AB",
      "number": 1005,
      "icode": null,
      "molecule": "RNA",
      "fullName": "AB.G1005",
      "shortName": "G",
      "chi": -148.10051684016406,
      "glycosidicBond": "anti"
    },
    {
      "index": 12,
      "chain": "AB",
      "number": 1006,
      "icode": null,
      "molecule": "RNA",
      "fullName": "AB.U1006",
      "shortName": "U",
      "chi": -137.28005568139977,
      "glycosidicBond": "anti"
    },
    {
      "index": 19,
      "chain": "AC",
      "number": 1001,
      "icode": null,
      "molecule": "RNA",
      "fullName": "AC.U1001",
      "shortName": "U",
      "chi": -141.92671313255747,
      "glycosidicBond": "anti"
    },
    {
      "index": 20,
      "chain": "AC",
      "number": 1002,
      "icode": null,
      "molecule": "RNA",
      "fullName": "AC.G1002",
      "shortName": "G",
      "chi": -165.93034671112116,
      "glycosidicBond": "anti"
    },
    {
      "index": 21,
      "chain": "AC",
      "number": 1003,
      "icode": null,
      "molecule": "RNA",
      "fullName": "AC.G1003",
      "shortName": "G",
      "chi": -121.56524260332263,
      "glycosidicBond": "anti"
    },
    {
      "index": 22,
      "chain": "AC",
      "number": 1004,
      "icode": null,
      "molecule": "RNA",
      "fullName": "AC.G1004",
      "shortName": "G",
      "chi": -156.00957673923352,
      "glycosidicBond": "anti"
    },
    {
      "index": 23,
      "chain": "AC",
      "number": 1005,
      "icode": null,
      "molecule": "RNA",
      "fullName": "AC.G1005",
      "shortName": "G",
      "chi": -148.1005168401641,
      "glycosidicBond": "anti"
    },
    {
      "index": 24,
      "chain": "AC",
      "number": 1006,
      "icode": null,
      "molecule": "RNA",
      "fullName": "AC.U1006",
      "shortName": "U",
      "chi": -137.28005568139986,
      "glycosidicBond": "anti"
    },
    {
      "index": 25,
      "chain": "B",
      "number": 2001,
      "icode": null,
      "molecule": "RNA",
      "fullName": "B.U2001",
      "shortName": "U",
      "chi": -146.4615316869476,
      "glycosidicBond": "anti"
    },
    {
      "index": 26,
      "chain": "B",
      "number": 2002,
      "icode": null,
      "molecule": "RNA",
      "fullName": "B.G2002",
      "shortName": "G",
      "chi": -170.79660912745996,
      "glycosidicBond": "anti"
    },
    {
      "index": 27,
      "chain": "B",
      "number": 2003,
      "icode": null,
      "molecule": "RNA",
      "fullName": "B.G2003",
      "shortName": "G",
      "chi": -117.68718110874113,
      "glycosidicBond": "anti"
    },
    {
      "index": 28,
      "chain": "B",
      "number": 2004,
      "icode": null,
      "molecule": "RNA",
      "fullName": "B.G2004",
      "shortName": "G",
      "chi": -153.88587375071324,
      "glycosidicBond": "anti"
    },
    {
      "index": 29,
      "chain": "B",
      "number": 2005,
      "icode": null,
      "molecule": "RNA",
      "fullName": "B.G2005",
      "shortName": "G",
      "chi": -148.85199128456694,
      "glycosidicBond": "anti"
    },
    {
      "index": 30,
      "chain": "B",
      "number": 2006,
      "icode": null,
      "molecule": "RNA",
      "fullName": "B.U2006",
      "shortName": "U",
      "chi": -159.43730655241544,
      "glycosidicBond": "anti"
    },
    {
      "index": 37,
      "chain": "BA",
      "number": 2001,
      "icode": null,
      "molecule": "RNA",
      "fullName": "BA.U2001",
      "shortName": "U",
      "chi": -146.46153168694764,
      "glycosidicBond": "anti"
    },
    {
      "index": 38,
      "chain": "BA",
      "number": 2002,
      "icode": null,
      "molecule": "RNA",
      "fullName": "BA.G2002",
      "shortName": "G",
      "chi": -170.7966091274599,
      "glycosidicBond": "anti"
    },
    {
      "index": 39,
      "chain": "BA",
      "number": 2003,
      "icode": null,
      "molecule": "RNA",
      "fullName": "BA.G2003",
      "shortName": "G",
      "chi": -117.68718110874113,
      "glycosidicBond": "anti"
    },
    {
      "index": 40,
      "chain": "BA",
      "number": 2004,
      "icode": null,
      "molecule": "RNA",
      "fullName": "BA.G2004",
      "shortName": "G",
      "chi": -153.88587375071322,
      "glycosidicBond": "anti"
    },
    {
      "index": 41,
      "chain": "BA",
      "number": 2005,
      "icode": null,
      "molecule": "RNA",
      "fullName": "BA.G2005",
      "shortName": "G",
      "chi": -148.851991284567,
      "glycosidicBond": "anti"
    },
    {
      "index": 42,
      "chain": "BA",
      "number": 2006,
      "icode": null,
      "molecule": "RNA",
      "fullName": "BA.U2006",
      "shortName": "U",
      "chi": -159.43730655241544,
      "glycosidicBond": "anti"
    },
    {
      "index": 43,
      "chain": "BB",
      "number": 2001,
      "icode": null,
      "molecule": "RNA",
      "fullName": "BB.U2001",
      "shortName": "U",
      "chi": -146.4615316869476,
      "glycosidicBond": "anti"
    },
    {
      "index": 44,
      "chain": "BB",
      "number": 2002,
      "icode": null,
      "molecule": "RNA",
      "fullName": "BB.G2002",
      "shortName": "G",
      "chi": -170.79660912745993,
      "glycosidicBond": "anti"
    },
    {
      "index": 45,
      "chain": "BB",
      "number": 2003,
      "icode": null,
      "molecule": "RNA",
      "fullName": "BB.G2003",
      "shortName": "G",
      "chi": -117.68718110874106,
      "glycosidicBond": "anti"
    },
    {
      "index": 46,
      "chain": "BB",
      "number": 2004,
      "icode": null,
      "molecule": "RNA",
      "fullName": "BB.G2004",
      "shortName": "G",
      "chi": -153.8858737507132,
      "glycosidicBond": "anti"
    },
    {
      "index": 47,
      "chain": "BB",
      "number": 2005,
      "icode": null,
      "molecule": "RNA",
      "fullName": "BB.G2005",
      "shortName": "G",
      "chi": -148.85199128456696,
      "glycosidicBond": "anti"
    },
    {
      "index": 48,
      "chain": "BB",
      "number": 2006,
      "icode": null,
      "molecule": "RNA",
      "fullName": "BB.U2006",
      "shortName": "U",
      "chi": -159.43730655241544,
      "glycosidicBond": "anti"
    },
    {
      "index": 31,
      "chain": "BC",
      "number": 2001,
      "icode": null,
      "molecule": "RNA",
      "fullName": "BC.U2001",
      "shortName": "U",
      "chi": -146.4615316869476,
      "glycosidicBond": "anti"
    },
    {
      "index": 32,
      "chain": "BC",
      "number": 2002,
      "icode": null,
      "molecule": "RNA",
      "fullName": "BC.G2002",
      "shortName": "G",
      "chi": -170.79660912745993,
      "glycosidicBond": "anti"
    },
    {
      "index": 33,
      "chain": "BC",
      "number": 2003,
      "icode": null,
      "molecule": "RNA",
      "fullName": "BC.G2003",
      "shortName": "G",
      "chi": -117.68718110874121,
      "glycosidicBond": "anti"
    },
    {
      "index": 34,
      "chain": "BC",
      "number": 2004,
      "icode": null,
      "molecule": "RNA",
      "fullName": "BC.G2004",
      "shortName": "G",
      "chi": -153.88587375071322,
      "glycosidicBond": "anti"
    },
    {
      "index": 35,
      "chain": "BC",
      "number": 2005,
      "icode": null,
      "molecule": "RNA",
      "fullName": "BC.G2005",
      "shortName": "G",
      "chi": -148.85199128456694,
      "glycosidicBond": "anti"
    },
    {
      "index": 36,
      "chain": "BC",
      "number": 2006,
      "icode": null,
      "molecule": "RNA",
      "fullName": "BC.U2006",
      "shortName": "U",
      "chi": -159.43730655241544,
      "glycosidicBond": "anti"
    }
  ],
  "basePairs": [
    {
      "nt1": "A.G1002",
      "nt2": "AB.G1002",
      "lw": "cWH",
      "inTetrad": true,
      "canonical": false
    },
    {
      "nt1": "A.G1002",
      "nt2": "AC.G1002",
      "lw": "cHW",
      "inTetrad": true,
      "canonical": false
    },
    {
      "nt1": "A.G1003",
      "nt2": "AB.G1003",
      "lw": "cWH",
      "inTetrad": true,
      "canonical": false
    },
    {
      "nt1": "A.G1003",
      "nt2": "AC.G1003",
      "lw": "cHW",
      "inTetrad": true,
      "canonical": false
    },
    {
      "nt1": "A.G1003",
      "nt2": "AC.G1004",
      "lw": "cSS",
      "inTetrad": false,
      "canonical": false
    },
    {
      "nt1": "A.G1004",
      "nt2": "AB.G1003",
      "lw": "cSS",
      "inTetrad": false,
      "canonical": false
    },
    {
      "nt1": "A.G1004",
      "nt2": "AB.G1004",
      "lw": "cWH",
      "inTetrad": true,
      "canonical": false
    },
    {
      "nt1": "A.G1004",
      "nt2": "AC.G1004",
      "lw": "cHW",
      "inTetrad": true,
      "canonical": false
    },
    {
      "nt1": "A.G1005",
      "nt2": "AB.G1005",
      "lw": "cWH",
      "inTetrad": true,
      "canonical": false
    },
    {
      "nt1": "A.G1005",
      "nt2": "AC.G1005",
      "lw": "cHW",
      "inTetrad": true,
      "canonical": false
    },
    {
      "nt1": "A.U1006",
      "nt2": "AB.U1006",
      "lw": "cHW",
      "inTetrad": true,
      "canonical": false
    },
    {
      "nt1": "A.U1006",
      "nt2": "AC.U1006",
      "lw": "cWH",
      "inTetrad": true,
      "canonical": false
    },
    {
      "nt1": "AB.G1002",
      "nt2": "AA.G1002",
      "lw": "cWH",
      "inTetrad": true,
      "canonical": false
    },
    {
      "nt1": "AA.G1002",
      "nt2": "AC.G1002",
      "lw": "cWH",
      "inTetrad": true,
      "canonical": false
    },
    {
      "nt1": "AB.G1003",
      "nt2": "AA.G1003",
      "lw": "cWH",
      "inTetrad": true,
      "canonical": false
    },
    {
      "nt1": "AB.G1004",
      "nt2": "AA.G1003",
      "lw": "cSS",
      "inTetrad": false,
      "canonical": false
    },
    {
      "nt1": "AA.G1003",
      "nt2": "AC.G1003",
      "lw": "cWH",
      "inTetrad": true,
      "canonical": false
    },
    {
      "nt1": "AB.G1004",
      "nt2": "AA.G1004",
      "lw": "cWH",
      "inTetrad": true,
      "canonical": false
    },
    {
      "nt1": "AA.G1004",
      "nt2": "AC.G1003",
      "lw": "cSS",
      "inTetrad": false,
      "canonical": false
    },
    {
      "nt1": "AA.G1004",
      "nt2": "AC.G1004",
      "lw": "cWH",
      "inTetrad": true,
      "canonical": false
    },
    {
      "nt1": "AB.G1005",
      "nt2": "AA.G1005",
      "lw": "cWH",
      "inTetrad": true,
      "canonical": false
    },
    {
      "nt1": "AA.G1005",
      "nt2": "AC.G1005",
      "lw": "cWH",
      "inTetrad": true,
      "canonical": false
    },
    {
      "nt1": "AB.U1006",
      "nt2": "AA.U1006",
      "lw": "cHW",
      "inTetrad": true,
      "canonical": false
    },
    {
      "nt1": "AA.U1006",
      "nt2": "AC.U1006",
      "lw": "cHW",
      "inTetrad": true,
      "canonical": false
    },
    {
      "nt1": "B.G2002",
      "nt2": "BB.G2002",
      "lw": "cHW",
      "inTetrad": true,
      "canonical": false
    },
    {
      "nt1": "B.G2002",
      "nt2": "BC.G2002",
      "lw": "cWH",
      "inTetrad": true,
      "canonical": false
    },
    {
      "nt1": "B.G2003",
      "nt2": "BB.G2003",
      "lw": "cHW",
      "inTetrad": true,
      "canonical": false
    },
    {
      "nt1": "B.G2003",
      "nt2": "BC.G2003",
      "lw": "cWH",
      "inTetrad": true,
      "canonical": false
    },
    {
      "nt1": "B.G2004",
      "nt2": "BB.G2004",
      "lw": "cHW",
      "inTetrad": true,
      "canonical": false
    },
    {
      "nt1": "B.G2004",
      "nt2": "BC.G2004",
      "lw": "cWH",
      "inTetrad": true,
      "canonical": false
    },
    {
      "nt1": "B.G2005",
      "nt2": "BB.G2005",
      "lw": "cHW",
      "inTetrad": true,
      "canonical": false
    },
    {
      "nt1": "B.G2005",
      "nt2": "BC.G2005",
      "lw": "cWH",
      "inTetrad": true,
      "canonical": false
    },
    {
      "nt1": "B.U2006",
      "nt2": "BB.U2006",
      "lw": "cWH",
      "inTetrad": true,
      "canonical": false
    },
    {
      "nt1": "B.U2006",
      "nt2": "BC.U2006",
      "lw": "cHW",
      "inTetrad": true,
      "canonical": false
    },
    {
      "nt1": "BA.G2002",
      "nt2": "BB.G2002",
      "lw": "cWH",
      "inTetrad": true,
      "canonical": false
    },
    {
      "nt1": "BC.G2002",
      "nt2": "BA.G2002",
      "lw": "cWH",
      "inTetrad": true,
      "canonical": false
    },
    {
      "nt1": "BA.G2003",
      "nt2": "BB.G2003",
      "lw": "cWH",
      "inTetrad": true,
      "canonical": false
    },
    {
      "nt1": "BC.G2003",
      "nt2": "BA.G2003",
      "lw": "cWH",
      "inTetrad": true,
      "canonical": false
    },
    {
      "nt1": "BC.G2004",
      "nt2": "BA.G2003",
      "lw": "cSS",
      "inTetrad": false,
      "canonical": false
    },
    {
      "nt1": "BA.G2004",
      "nt2": "BB.G2004",
      "lw": "cWH",
      "inTetrad": true,
      "canonical": false
    },
    {
      "nt1": "BC.G2004",
      "nt2": "BA.G2004",
      "lw": "cWH",
      "inTetrad": true,
      "canonical": false
    },
    {
      "nt1": "BA.G2005",
      "nt2": "BB.G2005",
      "lw": "cWH",
      "inTetrad": true,
      "canonical": false
    },
    {
      "nt1": "BC.G2005",
      "nt2": "BA.G2005",
      "lw": "cWH",
      "inTetrad": true,
      "canonical": false
    },
    {
      "nt1": "BA.U2006",
      "nt2": "BB.U2006",
      "lw": "cHW",
      "inTetrad": true,
      "canonical": false
    },
    {
      "nt1": "BC.U2006",
      "nt2": "BA.U2006",
      "lw": "cHW",
      "inTetrad": true,
      "canonical": false
    }
  ],
  "helices": [
    {
      "quadruplexes": [
        {
          "tetrads": [
            {
              "id": "A.U1006-AC.U1006-AA.U1006-AB.U1006",
              "nt1": "A.U1006",
              "nt2": "AC.U1006",
              "nt3": "AA.U1006",
              "nt4": "AB.U1006",
              "onz": "O-",
              "gbaClassification": "VIIIa",
              "planarityDeviation": 1.061,
              "ionsChannel": [],
              "ionsOutside": [
                {
                  "nt": "A.U1006",
                  "ion": "Sr"
                },
                {
                  "nt": "AA.U1006",
                  "ion": "Sr"
                },
                {
                  "nt": "AB.U1006",
                  "ion": "Sr"
                },
                {
                  "nt": "AC.U1006",
                  "ion": "Sr"
                }
              ]
            },
            {
              "id": "A.G1005-AC.G1005-AA.G1005-AB.G1005",
              "nt1": "A.G1005",
              "nt2": "AC.G1005",
              "nt3": "AA.G1005",
              "nt4": "AB.G1005",
              "onz": "O+",
              "gbaClassification": "VIIIa",
              "planarityDeviation": 0.7999999999999972,
              "ionsChannel": [],
              "ionsOutside": []
            },
            {
              "id": "A.G1004-AC.G1004-AA.G1004-AB.G1004",
              "nt1": "A.G1004",
              "nt2": "AC.G1004",
              "nt3": "AA.G1004",
              "nt4": "AB.G1004",
              "onz": "O+",
              "gbaClassification": "VIIIa",
              "planarityDeviation": 0.4059999999999988,
              "ionsChannel": [
                "Sr"
              ],
              "ionsOutside": []
            },
            {
              "id": "A.G1003-AC.G1003-AA.G1003-AB.G1003",
              "nt1": "A.G1003",
              "nt2": "AC.G1003",
              "nt3": "AA.G1003",
              "nt4": "AB.G1003",
              "onz": "O+",
              "gbaClassification": "VIIIa",
              "planarityDeviation": 0.5549999999999997,
              "ionsChannel": [
                "Sr"
              ],
              "ionsOutside": []
            },
            {
              "id": "A.G1002-AC.G1002-AA.G1002-AB.G1002",
              "nt1": "A.G1002",
              "nt2": "AC.G1002",
              "nt3": "AA.G1002",
              "nt4": "AB.G1002",
              "onz": "O+",
              "gbaClassification": "VIIIa",
              "planarityDeviation": 0.541999999999998,
              "ionsChannel": [],
              "ionsOutside": [
                {
                  "nt": "AB.G1002",
                  "ion": "Ca"
                },
                {
                  "nt": "AC.G1002",
                  "ion": "Ca"
                },
                {
                  "nt": "AA.G1002",
                  "ion": "Ca"
                },
                {
                  "nt": "A.G1002",
                  "ion": "Ca"
                }
              ]
            }
          ],
          "onzm": "Op*",
          "loopClassification": null,
          "gbaClassification": [
            "VIII"
          ],
          "tracts": [
            [
              "A.U1006",
              "A.G1005",
              "A.G1004",
              "A.G1003",
              "A.G1002"
            ],
            [
              "AC.U1006",
              "AC.G1005",
              "AC.G1004",
              "AC.G1003",
              "AC.G1002"
            ],
            [
              "AA.U1006",
              "AA.G1005",
              "AA.G1004",
              "AA.G1003",
              "AA.G1002"
            ],
            [
              "AB.U1006",
              "AB.G1005",
              "AB.G1004",
              "AB.G1003",
              "AB.G1002"
            ]
          ],
          "bulges": [],
          "loops": []
        },
        {
          "tetrads": [
            {
              "id": "B.G2002-BC.G2002-BA.G2002-BB.G2002",
              "nt1": "B.G2002",
              "nt2": "BC.G2002",
              "nt3": "BA.G2002",
              "nt4": "BB.G2002",
              "onz": "O+",
              "gbaClassification": "VIIIa",
              "planarityDeviation": 0.6730000000000018,
              "ionsChannel": [],
              "ionsOutside": []
            },
            {
              "id": "B.G2003-BC.G2003-BA.G2003-BB.G2003",
              "nt1": "B.G2003",
              "nt2": "BC.G2003",
              "nt3": "BA.G2003",
              "nt4": "BB.G2003",
              "onz": "O+",
              "gbaClassification": "VIIIa",
              "planarityDeviation": 0.5769999999999982,
              "ionsChannel": [
                "Sr"
              ],
              "ionsOutside": [
                {
                  "nt": "B.G2003",
                  "ion": "Ca"
                },
                {
                  "nt": "BA.G2003",
                  "ion": "Ca"
                },
                {
                  "nt": "BB.G2003",
                  "ion": "Ca"
                },
                {
                  "nt": "BC.G2003",
                  "ion": "Ca"
                }
              ]
            },
            {
              "id": "B.G2004-BC.G2004-BA.G2004-BB.G2004",
              "nt1": "B.G2004",
              "nt2": "BC.G2004",
              "nt3": "BA.G2004",
              "nt4": "BB.G2004",
              "onz": "O+",
              "gbaClassification": "VIIIa",
              "planarityDeviation": 0.2289999999999992,
              "ionsChannel": [
                "Sr"
              ],
              "ionsOutside": []
            },
            {
              "id": "B.G2005-BC.G2005-BA.G2005-BB.G2005",
              "nt1": "B.G2005",
              "nt2": "BC.G2005",
              "nt3": "BA.G2005",
              "nt4": "BB.G2005",
              "onz": "O+",
              "gbaClassification": "VIIIa",
              "planarityDeviation": 0.7810000000000006,
              "ionsChannel": [],
              "ionsOutside": []
            },
            {
              "id": "B.U2006-BC.U2006-BA.U2006-BB.U2006",
              "nt1": "B.U2006",
              "nt2": "BC.U2006",
              "nt3": "BA.U2006",
              "nt4": "BB.U2006",
              "onz": "O-",
              "gbaClassification": "VIIIa",
              "planarityDeviation": 1.5840000000000005,
              "ionsChannel": [
                "Na",
                "Na"
              ],
              "ionsOutside": []
            }
          ],
          "onzm": "Op*",
          "loopClassification": null,
          "gbaClassification": [
            "VIII"
          ],
          "tracts": [
            [
              "B.G2002",
              "B.G2003",
              "B.G2004",
              "B.G2005",
              "B.U2006"
            ],
            [
              "BC.G2002",
              "BC.G2003",
              "BC.G2004",
              "BC.G2005",
              "BC.U2006"
            ],
            [
              "BA.G2002",
              "BA.G2003",
              "BA.G2004",
              "BA.G2005",
              "BA.U2006"
            ],
            [
              "BB.G2002",
              "BB.G2003",
              "BB.G2004",
              "BB.G2005",
              "BB.U2006"
            ]
          ],
          "bulges": [],
          "loops": []
        }
      ],
      "tetradPairs": [
        {
          "tetrad1": "A.U1006-AC.U1006-AA.U1006-AB.U1006",
          "tetrad2": "A.G1005-AC.G1005-AA.G1005-AB.G1005",
          "direction": "parallel",
          "rise": 3.366499999999995,
          "twist": 39.962531742191736
        },
        {
          "tetrad1": "A.G1005-AC.G1005-AA.G1005-AB.G1005",
          "tetrad2": "A.G1004-AC.G1004-AA.G1004-AB.G1004",
          "direction": "parallel",
          "rise": 3.308000000000007,
          "twist": 25.89614444631925
        },
        {
          "tetrad1": "A.G1004-AC.G1004-AA.G1004-AB.G1004",
          "tetrad2": "A.G1003-AC.G1003-AA.G1003-AB.G1003",
          "direction": "parallel",
          "rise": 3.339499999999994,
          "twist": 35.81115298630443
        },
        {
          "tetrad1": "A.G1003-AC.G1003-AA.G1003-AB.G1003",
          "tetrad2": "A.G1002-AC.G1002-AA.G1002-AB.G1002",
          "direction": "parallel",
          "rise": 3.2865,
          "twist": 27.11515971986803
        },
        {
          "tetrad1": "A.G1002-AC.G1002-AA.G1002-AB.G1002",
          "tetrad2": "B.G2002-BC.G2002-BA.G2002-BB.G2002",
          "direction": "parallel",
          "rise": 3.369500000000002,
          "twist": 28.993180312675573
        },
        {
          "tetrad1": "B.G2002-BC.G2002-BA.G2002-BB.G2002",
          "tetrad2": "B.G2003-BC.G2003-BA.G2003-BB.G2003",
          "direction": "parallel",
          "rise": 3.371000000000002,
          "twist": 27.410084968596852
        },
        {
          "tetrad1": "B.G2003-BC.G2003-BA.G2003-BB.G2003",
          "tetrad2": "B.G2004-BC.G2004-BA.G2004-BB.G2004",
          "direction": "parallel",
          "rise": 3.318000000000005,
          "twist": 35.04072146975963
        },
        {
          "tetrad1": "B.G2004-BC.G2004-BA.G2004-BB.G2004",
          "tetrad2": "B.G2005-BC.G2005-BA.G2005-BB.G2005",
          "direction": "parallel",
          "rise": 3.2689999999999966,
          "twist": 25.149997949938147
        },
        {
          "tetrad1": "B.G2005-BC.G2005-BA.G2005-BB.G2005",
          "tetrad2": "B.U2006-BC.U2006-BA.U2006-BB.U2006",
          "direction": "parallel",
          "rise": 7.140499999999998,
          "twist": 43.40609492262336
        }
      ]
    }
  ],
  "dotBracket": {
    "sequence": "UGGGG-UUGGGG-UUGGGG-UUGGGG-UUGGGG-UUGGGG-UUGGGG-UUGGGGU",
    "line1": ".([{<-A.)]}>-(.[{<A-).]}>a-a.([{<-A.)]}>-(.[{<A-).]}>aa",
    "line2": ".([{<-(.[{<A-).]}>a-A.)]}>-a.([{<-(.[{<A-).]}>a-A.)]}>a"
  },
  "quadruplexDotBracket": {
    "sequence": "UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU",
    "structure": ".QRSTu-.qrstU-.QRSTu-.qrstU-.VWXYz-.vwxyZ-.VWXYz-.vwxyZ",
    "chi": "aaaaaa-aaaaaa-aaaaaa-aaaaaa-aaaaaa-aaaaaa-aaaaaa-aaaaaa",
    "loop": "......-......-......-......-......-......-......-......"
  }
}

Funding

This research was supported by the National Science Centre, Poland [2016/23/B/ST6/03931, 2019/35/B/ST6/03074] and Mloda Kadra project [09/91/SBAD/0684] from Poznan University of Technology, and carried out in the European Centre for Bioinformatics and Genomics (Poland). The authors also acknowledge partial support by the statutory funds of Poznan University of Technology, Polish Ministry of Science and Higher Education, and the Institute of Bioorganic Chemistry, PAS within intramural financing program.

Bibliography

  1. Topology-Based Classification of Tetrads and Quadruplex Structures. M. Popenda, J. Miskiewicz, J. Sarzynska, T. Zok, M. Szachniuk. Bioinformatics. 2020. 36(4):1129–1134. doi:10.1093/bioinformatics/btz738

  2. ElTetrado: A Tool for Identification and Classification of Tetrads and Quadruplexes. T. Zok, M. Popenda, M. Szachniuk. BMC Bioinformatics. 2020. 21(1):40. doi:10.1186/s12859-020-3385-1

  3. R-Chie : A Web Server and R Package for Visualizing RNA Secondary Structures. D. Lai, J.R. Proctor, J.Y.A. Zhu, I.M. Meyer. Nucleic Acids Research. 2012. 40(12):e95. doi:10/f99845

  4. Geometric Nomenclature and Classification of RNA Base Pairs. N.B. Leontis, E. Westhof. RNA. 2001. 7(4):499–512. doi:10.1017/s1355838201002515

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

eltetrado-1.7.2.tar.gz (36.3 kB view details)

Uploaded Source

Built Distribution

If you're not sure about the file name format, learn more about wheel file names.

eltetrado-1.7.2-py3-none-any.whl (31.2 kB view details)

Uploaded Python 3

File details

Details for the file eltetrado-1.7.2.tar.gz.

File metadata

  • Download URL: eltetrado-1.7.2.tar.gz
  • Upload date:
  • Size: 36.3 kB
  • Tags: Source
  • Uploaded using Trusted Publishing? No
  • Uploaded via: poetry/2.2.1 CPython/3.12.12 Linux/6.11.0-1018-azure

File hashes

Hashes for eltetrado-1.7.2.tar.gz
Algorithm Hash digest
SHA256 c54c10a249df01f780c5c7bbc861b14cf00170ce7eb9373fd2eddce03c01f1ad
MD5 4d9ba7a847c102728d72606a60fb7323
BLAKE2b-256 49b7d2d60796ef9eefc7f603e03ca8322e835004badc5ae8b1b2055dcc3e3de9

See more details on using hashes here.

File details

Details for the file eltetrado-1.7.2-py3-none-any.whl.

File metadata

  • Download URL: eltetrado-1.7.2-py3-none-any.whl
  • Upload date:
  • Size: 31.2 kB
  • Tags: Python 3
  • Uploaded using Trusted Publishing? No
  • Uploaded via: poetry/2.2.1 CPython/3.12.12 Linux/6.11.0-1018-azure

File hashes

Hashes for eltetrado-1.7.2-py3-none-any.whl
Algorithm Hash digest
SHA256 6121add32b9f40c05704ce9bd033d4aa02033c734cfdc7796345ce2a4999c963
MD5 04480d261debc88bd146e0509063c056
BLAKE2b-256 bbd28b71a7b196cafcedfd8c999355b2b7d3f130ab0fcc9d082d0dec1277115b

See more details on using hashes here.

Supported by

AWS Cloud computing and Security Sponsor Datadog Monitoring Depot Continuous Integration Fastly CDN Google Download Analytics Pingdom Monitoring Sentry Error logging StatusPage Status page