Skip to main content

A Python3 program that counts sequence occurences in fastq files.

Project description

Welcome to 2FAST2Q

A Python3 based program that counts sequence occurrences in FASTQ files 2FAST2Q is ideal for CRISPRi-Seq, and for extracting and counting any kind of information from Illumina reads, such as barcodes. 2FAST2Q can work with sequence mismatches, and can be used to find sequences delimited by known sequences in unaligned reads.

2FAST2Q requires absolutely no installation whatsoever, and can work with any classic CRISPRi experimental setup, or be used for any kind of sequence extraction from FASTQ files.

Check out my GitHub for the source files: https://github.com/afombravo/2FAST2Q

Before running:

Remove any "Undetermined" or unwanted fastq.gz files from the input folder as the program will attempt to align all the FASTQ files in the input folder.

How to use it

There are two versions of the program, with and without a basic user interface.

After installation, type the following to initialize the program using the graphical interface:

python -m fast2q

For the non-graphical interface (the graphical interface can be buggy, or not work in some OS), type:

python -m fast2q -c

When running without specified parameters, 2FAST2Q will assume the current running directory has all the required files:

one .csv corresponding to features file
the .FASTQ files

There are also several optional parameters. For their description and input type. A more in-depth description is provided below:

python -m fast2q -h

-h, --help show this help message and exit

-c [C] cmd line mode

--s S The full path to the directory with the sequencing files

--g G The full path to the .csv file with the features.

--o O The full path to the output directory

--se SE Sequencing file extension (ie:'.fastq.gz')

--m M number of allowed mismatches (default=1)

--ph PH Minimal Phred-score (default=30)

--st ST Feature start position in the read (default is 0==1st bp)

--l L Feature length

--us US Upstream search sequence

--ds DS Downstream search sequence

--ms MS mismatches allowed when searching reads with Up/Down stream sequences

--mo MO Running Mode (default=C) [Counter (C) / Extractor + Counter (EC)]

--cp CP Number of cpus to be used (default is max(cpu)-2 for >=3 cpus, -1 for >=2 cpus, 1 if 1 cpu

--k K If enabled, keeps all temporary files (default is disabled)

File Requirements

1. (Optional, only required when running in Counting mode)

Obtain a .csv file (this format can be obtained using the "save as" option in excel) with the nucleotide sequences of all used features, and their respective names (any name can be given, as long as it doesn’t repeat). See the provided "D39V_guides.csv" sample file.

sgRNA0001 AATAGCATAGAAATCATACA
sgRNA0002 AGTGTTGATTTACCAACGTT

2.

The program will initialize and ask, in turn, for directories and file paths. See the "inputs" section below for an explanation of these inputs.

Inputs

To run the program, three input paths are required:

1. directory containing the sequencing files

A path to the folder with either:

  1. all the compressed sequencing files (at the moment, the program unzips .gz files only)

    or

  2. all the uncompressed .fastq files

2. the path to the feature .csv file (optional)

A path to the .csv file with the feature. See example "D39V_guides.csv" for layout (remove any headers).

3. the output directory

A path to the output folder (for safety, a subfolder will always be created on this directory)

4. Parameters

The file extension type (default = fastq.gz) (change to the appropriate extension if uncompressed, for example ".fastq")

The minimal sequencing phred-score for each nucleotide (default = 30)

The start position of the feature within the read (default = 0, meaning the sequenced feature is located at the first position of the read sequence)

The lenght of the feature in bp (default = 20)

The number of allowed mismatches per feature (default = 1)

Keep temporary files mode (default = no). When enabled, deletes all temporary files. To keep all files, change to "n" in the graphical mode, or input the parameter --k in the cmd lines.

For extracting all sequences at a certain position in the read select the extractor + Counter (EC) mode. The default is Counter (C) mode only.

If the starting position varies within the read, it is possible to search for a delimiting known sequence, and then extract the sequence before/after it. In this case, it is allowed to input the following:

A 5' end search sequence, and the amount of bp the program should inventory after. A 3' end search sequence, and the amount of bp the program should inventory after. A 5'and 3' end search sequence, the program will return and count everything in between these two. How many mismatches are allowed in the search sequence.

While Running

=================================

2FAST2Q is coded to maximize any computer's processing power (it runs multiprocessed, so it can process various samples simultaneously). It is therefore advisable to not heavily use the computer while 2FAST2Q is running to avoid constraining the processor.

When running 2FAST2Q in the compiled form, the initialization sequence might take up to a minute. 2FAST2Q will be operational when "Version X.X.X" appears on the window. Depending on the used computer, 2FAST2Q might take a few minutes to run. If no errors are shown, 2FAST2Q is still running. GIVE IT TIME!

\\\\

macOS use WARNING!

When using the graphical user interface option, it's possible that the interface is buggy on some MacOS versions. In this case, it might be better to run the command line version via pip install fast2q

A completion message should be given at the end. In any case, the program will be finish when the compiled.csv file is visible in the directory.

Output

Upon completion, several files should be seen in the indicated output folder (when running in default mode only c, d, and e will be kept):

a. The uncompressed “*.fastq” files;

b. “*_reads.csv” files corresponding to the read counts per feature per inputted sequencing file;

c. A “compiled_stats.csv” containing all the relevant input/output information about the 2FAST2Q analysis;

d. A bar plot "reads_plot.png" representing the total number of reads, and valid reads, per sample;

e. A “compiled.csv” file with the compilation of all the read counts per feature in all the inputted files. Use this latter in the next steps of the data analysis pipeline.

Short Explanation

2FAST2Q will return the read counts for all the features present in the input file. A read will be aligned to its features if the minimum quality score in each nucleotide is >= the indicated phred-score, and if there is less than the indicated allowed mismatches. Like said before, these parameters can be modified by the user.

However, why these parameters?

Base quality filtering using Q>=30 means there is a 0.01% chance of a given nucleotide being miss-sequenced. To assure alignment quality, the program filters out by default any reads that have nucleotides with a Q < 30.

Why the mismatch?

To avoid a too highly stringent cutoff. Allowing a mismatch allows the alignment of reads to their features when just a single nucleotide is wrongly sequenced. Even at a 0.01% chance (Q>=30 default) this event is bound to happen due to the large sample size.

However, there is a safe mechanism in place to prevent 2 or more features with mismatches from being aligned to the same read (the read is discarded in this case, as there is no way of knowing to which feature the read aligns to)

Troubleshooting

Running 2FAST2Q with example data (see GitHub):

  1. Download the "D39V_guides.csv" file
  2. Download the "example.fastq.gz"
  3. Run 2FAST2Q

In this example, sgRNA0850 and sgRNA867 share the same sequence; this will appear as a warning message.

The expected example output file is given: "compiled.csv"

Common Errors:

Error Message Probable Cause/Fix
Please enter a valid directory for the following request: (see printed requests). Please close the program and start again You have entered an invalid file or folder location. Check that the correct folder/file was selected. When choosing a file click on the file. When selecting a folder, double click (go into the folder, no files will be visible. Its normal).
Please confirm that all the input boxes are filled. Some parameters are missing. Press any key to exit Click OK on the pop up parameter box. The wrong parameter format was entered. Please restart the program and re-introduce ALL the required paths (you must use the browse buttons for this), and parameters (or leave at default). Please close the program and start again
Only numeric values are accepted in the following fields: ... Introduce parameters that respect the default format (text and integers, when appropriate).
Warning!! X and Y share the same sequence. Only X will be considered valid. X and Y correspond to feature names. The indicated entries have the same sequence, and only the first will be considered valid.
Check the path to the feature file. No file found in the following path: X Confirm the indicated path (X) to the feature .csv file is correct
Check the path to the X files folder. No files of this type found. Confirm the indicated path to the folder with the sequencing (X) files is correct.
Program doesn’t initialize Confirm the downloaded program is the appropriate one for the current operating system. Contact the 2FAST2Q developer if the issue persists.
Program crashes, or behaves unexpectedly. Restart the program and carefully indicate the appropriate required input paths. Check if the program behaves as expected with the provided sample data. Contact the 2FAST2Q developer if the issue persists.

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

fast2q-2.3.4.tar.gz (20.0 kB view details)

Uploaded Source

Built Distribution

If you're not sure about the file name format, learn more about wheel file names.

fast2q-2.3.4-py3-none-any.whl (16.6 kB view details)

Uploaded Python 3

File details

Details for the file fast2q-2.3.4.tar.gz.

File metadata

  • Download URL: fast2q-2.3.4.tar.gz
  • Upload date:
  • Size: 20.0 kB
  • Tags: Source
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/3.4.1 importlib_metadata/3.10.0 pkginfo/1.7.0 requests/2.23.0 requests-toolbelt/0.9.1 tqdm/4.59.0 CPython/3.7.10

File hashes

Hashes for fast2q-2.3.4.tar.gz
Algorithm Hash digest
SHA256 d88bb8189353242e7618171d2a77895a27640d6691d263ec4904d3b71623111f
MD5 96017884961444750e260b524f0660aa
BLAKE2b-256 a7ed0c0a4457cc65bc9066181cd13b3d60812510dca543aa9ea233d66ad6da4d

See more details on using hashes here.

File details

Details for the file fast2q-2.3.4-py3-none-any.whl.

File metadata

  • Download URL: fast2q-2.3.4-py3-none-any.whl
  • Upload date:
  • Size: 16.6 kB
  • Tags: Python 3
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/3.4.1 importlib_metadata/3.10.0 pkginfo/1.7.0 requests/2.23.0 requests-toolbelt/0.9.1 tqdm/4.59.0 CPython/3.7.10

File hashes

Hashes for fast2q-2.3.4-py3-none-any.whl
Algorithm Hash digest
SHA256 a53b4bd9bf0932a0096229bbff7565964acfea883cc7fec53a86a908ed076a70
MD5 ab89f933014a639af780f7734a839fe2
BLAKE2b-256 952e4c404ef8d4d9ae4be020747804ba4cbad501ecd768f3733f39102575b199

See more details on using hashes here.

Supported by

AWS Cloud computing and Security Sponsor Datadog Monitoring Depot Continuous Integration Fastly CDN Google Download Analytics Pingdom Monitoring Sentry Error logging StatusPage Status page