Skip to main content

A library to encode text as DNA and decode DNA to text.

Project description

GeneSpeak

GitHub - License PyPI - Python Version PyPI - Package Version Conda - Platform Conda (channel only) Docs - GitHub.io

A library to encode text as DNA and decode DNA to text.

GeneSpeak allows you to encode regular text as DNA using base-pairs (A, T, G, C) and convert back to text. The coding scheme could be any combination of A, T, G, C.

Example

import genespeak as gp
print(f'{gp.__name__} version: {gp.__version__}')

schema = "ATCG"
text = "Hello World!"
dna = gp.text_to_dna(text, schema=schema)
print(f'Text: {text}\nEncoded DNA: {dna}\n')
text_from_dna = gp.dna_to_text(dna, schema=schema)
print(f'Text: {text}\nEncoded DNA: {dna}\nDecoded Text: {text_from_dna}\n')

Output

genespeak version: 0.0.3
Text: Hello World!
Encoded DNA: TACATCTTTCGATCGATCGGACAATTTGTCGGTGACTCGATCTAACAT

Text: Hello World!
Encoded DNA: TACATCTTTCGATCGATCGGACAATTTGTCGGTGACTCGATCTAACAT
Decoded Text: Hello World!

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

genespeak-0.0.4.tar.gz (8.8 kB view details)

Uploaded Source

Built Distribution

If you're not sure about the file name format, learn more about wheel file names.

genespeak-0.0.4-py3-none-any.whl (7.9 kB view details)

Uploaded Python 3

File details

Details for the file genespeak-0.0.4.tar.gz.

File metadata

  • Download URL: genespeak-0.0.4.tar.gz
  • Upload date:
  • Size: 8.8 kB
  • Tags: Source
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/3.7.1 importlib_metadata/4.8.2 pkginfo/1.8.2 requests/2.26.0 requests-toolbelt/0.9.1 tqdm/4.62.3 CPython/3.8.12

File hashes

Hashes for genespeak-0.0.4.tar.gz
Algorithm Hash digest
SHA256 c2caa7c16863a94baa4ec6f444baa3e2b6052b36a1602314c22d8d79fbb69446
MD5 dc32e4269e9e74fe95207fc213af3fed
BLAKE2b-256 b9be4026de3fb0c59cb47256bab6924a493d67ba0cb4bc0c927a625eeb17d832

See more details on using hashes here.

File details

Details for the file genespeak-0.0.4-py3-none-any.whl.

File metadata

  • Download URL: genespeak-0.0.4-py3-none-any.whl
  • Upload date:
  • Size: 7.9 kB
  • Tags: Python 3
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/3.7.1 importlib_metadata/4.8.2 pkginfo/1.8.2 requests/2.26.0 requests-toolbelt/0.9.1 tqdm/4.62.3 CPython/3.8.12

File hashes

Hashes for genespeak-0.0.4-py3-none-any.whl
Algorithm Hash digest
SHA256 0483bd7727c0f4a1947ddcb5782f5d6105e5f24ec5653cdeaaef7e42f7435000
MD5 ec1527c5dc1e1052d5b7ae8c9faf8297
BLAKE2b-256 305e40c3cef57cd82be32245a0e4bd7839d7a95e17d410b85d7a80d3c2ac948f

See more details on using hashes here.

Supported by

AWS Cloud computing and Security Sponsor Datadog Monitoring Depot Continuous Integration Fastly CDN Google Download Analytics Pingdom Monitoring Sentry Error logging StatusPage Status page