genomic-tokenizer 0.1.0

Genomic Tokenizer

:chains: Genomic Tokenizer

About

This is a tokenizer for DNA :chains: that aligns with the central dogma of molecular biology. You can use this tokenizer for training genomic transformer models. See the BERT and GPT2 models trained on human genome. This is not tested yet, but feel free to try it and improve it. Please cite / contact me if you use it in your research.

🚀 Installation

pip install git+https://github.com/dermatologist/genomic-tokenizer.git

🔧 Example usage

from genomic_tokenizer import GenomicTokenizer
# Fasta header if present is ignored.
fasta = """
AGGCGAGGCGCGGGCGGAGGCGGTGCGCGGGCGGAGGCGGGGCGCGGAGATGTGGCGGAGGTGGAGGCGG
AGGCGTAGCCGCCCCTGGGGACGTCATTGGTGGCGGAAGCAATCGCCGGCAACCAGCTGTAAGCGAGGTA
GGCTCACTCGGGCACGGAGGGTGCGGGTGAGAAAGGGAACGATTTGCTAGGAGTGTATGCGCCCGTGCTA
"""
model_max_length = 2048
tokenizer = GenomicTokenizer(model_max_length)
tokens = tokenizer(fasta)
print(tokens)

✨ Output

{'input_ids': [2, 7, 12, 17, 19, 16, 1, 7, 20, 6, 12, 21, 16, 12, 20, 12, 12, 8, 12, 1, 10, 20, 10, 20, 11, 7, 20, 21, 23, 8, 7, 20, 7, 6, 12, 21, 19, 10, 11, 16, 19, 7, 1, 22, 7, 1, 19, 21, 7, 16, 1, 21, 12, 23, 19, 12, 20, 6, 1],
'token_type_ids': [0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0],
'attention_mask': [1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1]}

🔧 Tokenization algorithm

• Identify the first occurence of the start codon ATG.
• Split the sequence into codons of length 3 starting from the start codon.
• Convert synonymous codons to the same token.
• Convert stop codons to [SEP] token.

🧠 Inspired by

• https://github.com/HazyResearch/hyena-dna/blob/main/src/dataloaders/datasets/hg38_char_tokenizer.py
• https://github.com/dariush-bahrami/character-tokenizer/blob/master/charactertokenizer/core.py
• And the CanineTokenizer in transformers package.
• Read this article for details on more elaborate tokenization strategies.

:books: Cite

@misc{genomic-tokenizer,
  author = {Bell Raj Eapen},
  title = {Genomic Tokenizer},
  year = {2024},
  publisher = {GitHub},
  journal = {GitHub repository},
  howpublished = {\url{
    https://github.com/dermatologist/genomic-tokenizer
    }},
}

Give us a star ⭐️

If you find this project useful, give us a star. It helps others discover the project.

Contributors

• Bell Eapen |