This is a pre-production deployment of Warehouse, however changes made here WILL affect the production instance of PyPI.
Latest Version Dependencies status unknown Test status unknown Test coverage unknown
Project Description
### Sequence Feature Detection and Mapping

This repository consists of two tools: Giraffe and Hippo. Giraffe includes a
set of javascripts that visualize sequences and sequence features, and a Django
app that detects features, restriction sites, and ORFs from a sequence. You can
use the javascripts independently from the Django program. Hippo is a Django
frontend for managing NCBI blast databases. User can create sequences, assign
them to databases, and use Django management commands to build NCBI blast
databases. Giraffe uses NCBI blast databases, for example, to detect features
in a sequence.

Hippo and Giraffe provide a convenient way to use Blast for your own
application. You can build blast databases using Hippo, then use Giraffe to
blast query sequence against the database. Hippo offers a Django admin UI to
manage the blast DB, while Giraffe handles calling blast, parsing blast
results, and visualizing detected features.

This software was originally written by Misha Wolfson and Benjie Chen,
copyrighted by Addgene, and released under the MIT License. See LICENSE file.
It is now maintained by Benjie Chen.

### Giraffe - Visualization

You can use Giraffe javascripts independently of the Django service, to
visualize a sequence you already have a list of features for.

See src/giraffe/templates/giraffe/{analyze,draw}.html.

### Giraffe - Sequence feature detection


* System requirements: see provison/ (you can use this to
provision a Vagrant instance, e.g.)

* Python requirements: pip install -r requirements.txt
(Currently supports Django 1.5 or higher)

* NCBI: install NCBI Blast toolkit (this takes awhile): cd ncbi; . install

Install Django service and build default database:

git clone
cd giraffe
(cd src; python migrate)
(cd src; python build_blastdb)

Run test server:

cd src; python runserver

Then goto

### API

You can POST a sequence to "/giraffe/analyze/", with the following params:


This will return a JSON array of [sequence_len, array of features, sequence].

Programmatically, you can construct new blast databases using Hippo. E.g.

from hippo.models import Feature, Feature_Type, Feature_Database
db = Feature_Database(name='my_db')
ft = Feature_Type.objects.get(type='Promoter')
feature = Feature(type=ft, name='Promoter1', sequence='AGCTATTTCGGAGTCGGCGATTACGATCGGCGATCG')

You can then query against database. E.g.

from hippo.models import Feature_Database
from giraffe.features import blast

db = Feature_Database.objects.get(name='my_db')
query = '...' # some query sequence
features = blast(query, db)

### Hippo as a BLAST frontend

Use Django admin to add features, group features into databases. Use the
build_blastdb django management command to build your databases, then Giraffe
can use the databases for feature detection. Alternatively, call the
```build``` method on a ```Feature_Database object``` directly.
Release History

Release History


This version

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

Download Files

Download Files

TODO: Brief introduction on what you do with files - including link to relevant help section.

File Name & Checksum SHA256 Checksum Help Version File Type Upload Date
giraffe-2.0.tar.gz (15.9 kB) Copy SHA256 Checksum SHA256 Source Apr 14, 2014

Supported By

WebFaction WebFaction Technical Writing Elastic Elastic Search Pingdom Pingdom Monitoring Dyn Dyn DNS HPE HPE Development Sentry Sentry Error Logging CloudAMQP CloudAMQP RabbitMQ Heroku Heroku PaaS Kabu Creative Kabu Creative UX & Design Fastly Fastly CDN DigiCert DigiCert EV Certificate Rackspace Rackspace Cloud Servers DreamHost DreamHost Log Hosting