Documentation | Paper | Tutorials | Installation
Protein & Interactomic Graph Library
This package provides functionality for producing geometric representations of protein and RNA structures, and biological interaction networks. We provide compatibility with standard PyData formats, as well as graph objects designed for ease of use with popular deep learning libraries.
What's New?
Example usage
Graphein provides both a programmatic API and a command-line interface for constructing graphs.
CLI
Graphein configs can be specified as .yaml files to batch process graphs from the commandline.
graphein -c config.yaml -p path/to/pdbs -o path/to/output
Creating a Protein Graph
| Tutorial (Residue-level) | Tutorial (Atomic) | Docs |
from graphein.protein.config import ProteinGraphConfig
from graphein.protein.graphs import construct_graph
config = ProteinGraphConfig()
g = construct_graph(config=config, pdb_code="3eiy")
Creating a Protein Graph from the AlphaFold Protein Structure Database
| Tutorial | Docs |
from graphein.protein.config import ProteinGraphConfig
from graphein.protein.graphs import construct_graph
from graphein.protein.utils import download_alphafold_structure
config = ProteinGraphConfig()
fp = download_alphafold_structure("Q5VSL9", aligned_score=False)
g = construct_graph(config=config, path=fp)
Creating a Protein Mesh
| Tutorial | Docs |
from graphein.protein.config import ProteinMeshConfig
from graphein.protein.meshes import create_mesh
verts, faces, aux = create_mesh(pdb_code="3eiy", config=config)
Creating Molecular Graphs
Graphein can create molecular graphs from smiles strings as well as .sdf, .mol2, and .pdb files
| Tutorial | Docs |
from graphein.molecule.config import MoleculeGraphConfig
from graphein.molecule.graphs import construct_graph
g = create_graph(smiles="CC(=O)OC1=CC=CC=C1C(=O)O", config=config)
Creating an RNA Graph
| Tutorial | Docs |
from graphein.rna.graphs import construct_rna_graph
# Build the graph from a dotbracket & optional sequence
rna = construct_rna_graph(dotbracket='..(((((..(((...)))..)))))...',
sequence='UUGGAGUACACAACCUGUACACUCUUUC')
Creating a Protein-Protein Interaction Graph
| Tutorial | Docs |
from graphein.ppi.config import PPIGraphConfig
from graphein.ppi.graphs import compute_ppi_graph
from graphein.ppi.edges import add_string_edges, add_biogrid_edges
config = PPIGraphConfig()
protein_list = ["CDC42", "CDK1", "KIF23", "PLK1", "RAC2", "RACGAP1", "RHOA", "RHOB"]
g = compute_ppi_graph(config=config,
protein_list=protein_list,
edge_construction_funcs=[add_string_edges, add_biogrid_edges]
)
Creating a Gene Regulatory Network Graph
| Tutorial | Docs |
from graphein.grn.config import GRNGraphConfig
from graphein.grn.graphs import compute_grn_graph
from graphein.grn.edges import add_regnetwork_edges, add_trrust_edges
config = GRNGraphConfig()
gene_list = ["AATF", "MYC", "USF1", "SP1", "TP53", "DUSP1"]
g = compute_grn_graph(
gene_list=gene_list,
edge_construction_funcs=[
partial(add_trrust_edges, trrust_filtering_funcs=config.trrust_config.filtering_functions),
partial(add_regnetwork_edges, regnetwork_filtering_funcs=config.regnetwork_config.filtering_functions),
],
)
Installation
Pip
The simplest install is via pip. N.B this does not install ML/DL libraries which are required for conversion to their data formats and for generating protein structure meshes with PyTorch 3D. Further details
pip install graphein # For base install
pip install graphein[extras] # For additional featurisation dependencies
pip install graphein[dev] # For dev dependencies
pip install graphein[all] # To get the lot
However, there are a number of (optional) utilities (DSSP, PyMol, GetContacts) that are not available via PyPI:
conda install -c salilab dssp # Required for computing secondary structural features
conda install -c schrodinger pymol # Required for PyMol visualisations & mesh generation
# GetContacts - used as an alternative way to compute intramolecular interactions
conda install -c conda-forge vmd-python
git clone https://github.com/getcontacts/getcontacts
# Add folder to PATH
echo "export PATH=\$PATH:`pwd`/getcontacts" >> ~/.bashrc
source ~/.bashrc
To test the installation, run:
cd getcontacts/example/5xnd
get_dynamic_contacts.py --topology 5xnd_topology.pdb \
--trajectory 5xnd_trajectory.dcd \
--itypes hb \
--output 5xnd_hbonds.tsv
Conda environment
The dev environment includes GPU Builds (CUDA 11.1) for each of the deep learning libraries integrated into graphein.
git clone https://www.github.com/a-r-j/graphein
cd graphein
conda env create -f environment-dev.yml
pip install -e .
A lighter install can be performed with:
git clone https://www.github.com/a-r-j/graphein
cd graphein
conda env create -f environment.yml
pip install -e .
Dockerfile
We provide two docker-compose files for CPU (docker-compose.cpu.yml) and GPU usage (docker-compose.yml) locally. For GPU usage please ensure that you have NVIDIA Container Toolkit installed. Ensure that you install the locally mounted volume after entering the container (pip install -e .). This will also setup the dev environment locally.
To build (GPU) run:
docker-compose up -d --build # start the container
docker-compose down # stop the container
Citing Graphein
Please consider citing graphein if it proves useful in your work.
@inproceedings{jamasb2022graphein,
title={Graphein - a Python Library for Geometric Deep Learning and Network Analysis on Biomolecular Structures and Interaction Networks},
author={Arian Rokkum Jamasb and Ramon Vi{\~n}as Torn{\'e} and Eric J Ma and Yuanqi Du and Charles Harris and Kexin Huang and Dominic Hall and Pietro Lio and Tom Leon Blundell},
booktitle={Advances in Neural Information Processing Systems},
editor={Alice H. Oh and Alekh Agarwal and Danielle Belgrave and Kyunghyun Cho},
year={2022},
url={https://openreview.net/forum?id=9xRZlV6GfOX}
}
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
Built Distribution
Filter files by name, interpreter, ABI, and platform.
If you're not sure about the file name format, learn more about wheel file names.
Copy a direct link to the current filters
File details
Details for the file graphein-1.7.8.tar.gz.
File metadata
- Download URL: graphein-1.7.8.tar.gz
- Upload date:
- Size: 264.8 kB
- Tags: Source
- Uploaded using Trusted Publishing? No
- Uploaded via: twine/6.1.0 CPython/3.13.7
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
0efe63565e938d2402ce898772f76cfcab3e5e91dc31d0b89ce359555342a1e2
|
|
| MD5 |
c324d02a3b5c0d75273dc62e1ec60203
|
|
| BLAKE2b-256 |
8acbd86a870869a5ded1f63817b79a4e6b8c77ee245b63ffd032047346024f18
|
File details
Details for the file graphein-1.7.8-py3-none-any.whl.
File metadata
- Download URL: graphein-1.7.8-py3-none-any.whl
- Upload date:
- Size: 317.0 kB
- Tags: Python 3
- Uploaded using Trusted Publishing? No
- Uploaded via: twine/6.1.0 CPython/3.13.7
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
c5f42e2910676ec4e0a0ee16fe4b8518b1ff2ff1c8106485e03622439c582e9b
|
|
| MD5 |
a3b9b56cfd1e62677a922f4cc340e6ab
|
|
| BLAKE2b-256 |
d3bf33fdca9dc53195e8d6bcfa391c2204562ff4f856548d6c779d4a1fb7a268
|