Skip to main content

Protein & Interactomic Graph Construction for Machine Learning

Project description

Binder PyPI version supported python versions Docs DOI:10.1101/2020.07.15.204701 Project Status: Active – The project has reached a stable, usable state and is being actively developed. Project Status: Active – The project has reached a stable, usable state and is being actively developed. CodeFactor Quality Gate Status Bugs Maintainability Rating Reliability Rating Gitter chat License: MIT Code style: black



Documentation | Paper | Tutorials | Installation

Protein & Interactomic Graph Library

This package provides functionality for producing geometric representations of protein and RNA structures, and biological interaction networks. We provide compatibility with standard PyData formats, as well as graph objects designed for ease of use with popular deep learning libraries.

What's New?

1.7.0 FoldComp Datasets Open In Colab
1.7.0 Creating Datasets from the PDB Open In Colab
1.6.0 Protein Tensor Module Open In Colab
1.5.0 Protein Graph Creation from AlphaFold2! Open In Colab
1.5.0 RNA Graph Construction from Dotbracket notation Open In Colab
1.4.0 Constructing molecular graphs Open In Colab
1.3.0 Ready-to-go Dataloaders for PyTorch Geometric Open In Colab
1.2.0 Extracting subgraphs from protein graphs Open In Colab
1.2.0 Protein Graph Analytics Open In Colab
1.2.0 Graphein CLI
1.2.0 Protein Graph Visualisation! Open In Colab
1.1.0 Protein - Protein Interaction Network Support & Structural Interactomics (Using AlphaFold2!) Open In Colab
1.0.0 High and Low-level API for massive flexibility - create your own bespoke workflows! Open In Colab

Example usage

Graphein provides both a programmatic API and a command-line interface for constructing graphs.

CLI

Graphein configs can be specified as .yaml files to batch process graphs from the commandline.

Docs

graphein -c config.yaml -p path/to/pdbs -o path/to/output

Creating a Protein Graph

Tutorial (Residue-level) Tutorial (Atomic) Docs
Open In Colab Open In Colab(https://colab.research.google.com/assets/colab-badge.svg)
from graphein.protein.config import ProteinGraphConfig
from graphein.protein.graphs import construct_graph

config = ProteinGraphConfig()
g = construct_graph(config=config, pdb_code="3eiy")

Creating a Protein Graph from the AlphaFold Protein Structure Database

Tutorial Docs
Open In Colab
from graphein.protein.config import ProteinGraphConfig
from graphein.protein.graphs import construct_graph
from graphein.protein.utils import download_alphafold_structure

config = ProteinGraphConfig()
fp = download_alphafold_structure("Q5VSL9", aligned_score=False)
g = construct_graph(config=config, path=fp)

Creating a Protein Mesh

Tutorial Docs
Open In Colab
from graphein.protein.config import ProteinMeshConfig
from graphein.protein.meshes import create_mesh

verts, faces, aux = create_mesh(pdb_code="3eiy", config=config)

Creating Molecular Graphs

Graphein can create molecular graphs from smiles strings as well as .sdf, .mol2, and .pdb files

Tutorial Docs
Open In Colab
from graphein.molecule.config import MoleculeGraphConfig
from graphein.molecule.graphs import construct_graph

g = create_graph(smiles="CC(=O)OC1=CC=CC=C1C(=O)O", config=config)

Creating an RNA Graph

Tutorial Docs
Open In Colab
from graphein.rna.graphs import construct_rna_graph
# Build the graph from a dotbracket & optional sequence
rna = construct_rna_graph(dotbracket='..(((((..(((...)))..)))))...',
                          sequence='UUGGAGUACACAACCUGUACACUCUUUC')

Creating a Protein-Protein Interaction Graph

Tutorial Docs
Open In Colab
from graphein.ppi.config import PPIGraphConfig
from graphein.ppi.graphs import compute_ppi_graph
from graphein.ppi.edges import add_string_edges, add_biogrid_edges

config = PPIGraphConfig()
protein_list = ["CDC42", "CDK1", "KIF23", "PLK1", "RAC2", "RACGAP1", "RHOA", "RHOB"]

g = compute_ppi_graph(config=config,
                      protein_list=protein_list,
                      edge_construction_funcs=[add_string_edges, add_biogrid_edges]
                     )

Creating a Gene Regulatory Network Graph

Tutorial Docs
Open In Colab
from graphein.grn.config import GRNGraphConfig
from graphein.grn.graphs import compute_grn_graph
from graphein.grn.edges import add_regnetwork_edges, add_trrust_edges

config = GRNGraphConfig()
gene_list = ["AATF", "MYC", "USF1", "SP1", "TP53", "DUSP1"]

g = compute_grn_graph(
    gene_list=gene_list,
    edge_construction_funcs=[
        partial(add_trrust_edges, trrust_filtering_funcs=config.trrust_config.filtering_functions),
        partial(add_regnetwork_edges, regnetwork_filtering_funcs=config.regnetwork_config.filtering_functions),
    ],
)

Installation

Pip

The simplest install is via pip. N.B this does not install ML/DL libraries which are required for conversion to their data formats and for generating protein structure meshes with PyTorch 3D. Further details

pip install graphein # For base install
pip install graphein[extras] # For additional featurisation dependencies
pip install graphein[dev] # For dev dependencies
pip install graphein[all] # To get the lot

However, there are a number of (optional) utilities (DSSP, PyMol, GetContacts) that are not available via PyPI:

conda install -c salilab dssp # Required for computing secondary structural features
conda install -c schrodinger pymol # Required for PyMol visualisations & mesh generation

# GetContacts - used as an alternative way to compute intramolecular interactions
conda install -c conda-forge vmd-python
git clone https://github.com/getcontacts/getcontacts

# Add folder to PATH
echo "export PATH=\$PATH:`pwd`/getcontacts" >> ~/.bashrc
source ~/.bashrc
To test the installation, run:

cd getcontacts/example/5xnd
get_dynamic_contacts.py --topology 5xnd_topology.pdb \
                        --trajectory 5xnd_trajectory.dcd \
                        --itypes hb \
                        --output 5xnd_hbonds.tsv

Conda environment

The dev environment includes GPU Builds (CUDA 11.1) for each of the deep learning libraries integrated into graphein.

git clone https://www.github.com/a-r-j/graphein
cd graphein
conda env create -f environment-dev.yml
pip install -e .

A lighter install can be performed with:

git clone https://www.github.com/a-r-j/graphein
cd graphein
conda env create -f environment.yml
pip install -e .

Dockerfile

We provide two docker-compose files for CPU (docker-compose.cpu.yml) and GPU usage (docker-compose.yml) locally. For GPU usage please ensure that you have NVIDIA Container Toolkit installed. Ensure that you install the locally mounted volume after entering the container (pip install -e .). This will also setup the dev environment locally.

To build (GPU) run:

docker-compose up -d --build # start the container
docker-compose down # stop the container

Citing Graphein

Please consider citing graphein if it proves useful in your work.

@inproceedings{jamasb2022graphein,
  title={Graphein - a Python Library for Geometric Deep Learning and Network Analysis on Biomolecular Structures and Interaction Networks},
  author={Arian Rokkum Jamasb and Ramon Vi{\~n}as Torn{\'e} and Eric J Ma and Yuanqi Du and Charles Harris and Kexin Huang and Dominic Hall and Pietro Lio and Tom Leon Blundell},
  booktitle={Advances in Neural Information Processing Systems},
  editor={Alice H. Oh and Alekh Agarwal and Danielle Belgrave and Kyunghyun Cho},
  year={2022},
  url={https://openreview.net/forum?id=9xRZlV6GfOX}
}

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

graphein-1.7.7.tar.gz (263.8 kB view details)

Uploaded Source

Built Distribution

If you're not sure about the file name format, learn more about wheel file names.

graphein-1.7.7-py3-none-any.whl (316.0 kB view details)

Uploaded Python 3

File details

Details for the file graphein-1.7.7.tar.gz.

File metadata

  • Download URL: graphein-1.7.7.tar.gz
  • Upload date:
  • Size: 263.8 kB
  • Tags: Source
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/5.1.1 CPython/3.12.6

File hashes

Hashes for graphein-1.7.7.tar.gz
Algorithm Hash digest
SHA256 1daec38829c245b2e17257e4642327e66a937a9dde30aacad7e06e1134730d3f
MD5 e4bfda9f728c56e7b752c7627c15bcb8
BLAKE2b-256 a8f809b261b437a1a9a2c73a7e31fc3b128e713600e3046a828996409aafc46a

See more details on using hashes here.

File details

Details for the file graphein-1.7.7-py3-none-any.whl.

File metadata

  • Download URL: graphein-1.7.7-py3-none-any.whl
  • Upload date:
  • Size: 316.0 kB
  • Tags: Python 3
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/5.1.1 CPython/3.12.6

File hashes

Hashes for graphein-1.7.7-py3-none-any.whl
Algorithm Hash digest
SHA256 a1683cd4f5d6b4b5a00391c7b90494f4b58ea2aee556679fb57512b424e4ed90
MD5 29cfc3ab886bc5953e260b52aa92ccce
BLAKE2b-256 705a23be3e8d1bfbcb9dec698cfd18e208acc2f4864ff9f3b6ffb257c53eaf24

See more details on using hashes here.

Supported by

AWS Cloud computing and Security Sponsor Datadog Monitoring Depot Continuous Integration Fastly CDN Google Download Analytics Pingdom Monitoring Sentry Error logging StatusPage Status page