hcrprobedesign 0.3.1

Probe Design tool for Hybridization Chain Reaction

HCRProbeDesign

Overview

HCRProbeDesign is a command-line and Python package for designing HCR v3.0 split-initiator probe pairs from a target FASTA sequence. It tiles target sequences, filters by GC content, melting temperature, homopolymers, and hairpins, and can optionally enforce genome uniqueness with Bowtie2.

Key tools:

• designProbes: primary probe design CLI.
• designProbesBatch: batch probe design for multi-record FASTA inputs.
• fetchMouseIndex: download, install, and register the mm10 Bowtie2 index.
• buildGenomeIndex: build and register a new reference genome index.
• listReferences: display installed reference genomes and default parameters.

Documentation: https://www.gofflab.org/HCRProbeDesign/

Installation

Prerequisites

• Python >= 3.6
• Bowtie2 (bowtie2 and bowtie2-build) for genome masking and index building
• Python dependencies are installed via pip (primer3-py, biopython, beautifulsoup4, pysam, zipfile36, pyyaml)

Install from PyPI

pip install hcrprobedesign

Install from source

git clone https://github.com/gofflab/HCRProbeDesign.git
cd HCRProbeDesign

# Optional: use the provided conda environment
conda env create -f environment.yaml
conda activate HCRProbeDesign

# Install the package
pip install -e .

Data directory

HCRProbeDesign stores configuration and Bowtie2 indices in a persistent user data directory at ~/.hcrprobedesign/ so they survive package upgrades. Override the location with the HCRPROBEDESIGN_DATA_DIR environment variable.

Adding a new reference genome

HCRProbeDesign keeps Bowtie2 index paths in ~/.hcrprobedesign/HCRconfig.yaml. The buildGenomeIndex utility builds an index and registers it automatically.

buildGenomeIndex --species zebrafish --fasta /path/to/genome.fa --threads 8

Notes:

• --fasta can be repeated and can point to a directory; all .fa, .fasta, or .fna files inside will be used.
• By default, indices are written under ~/.hcrprobedesign/indices/ and the config is updated.
• Use --indices-dir to write indices elsewhere and --config to update a specific config file.
• Use --force to overwrite an existing index or config entry.

If you are working with mouse (mm10), you can use the prebuilt index:

fetchMouseIndex

This updates HCRconfig.yaml so designProbes --species mouse works out of the box.

Listing installed references

To see which reference genomes are registered and ready to use:

listReferences

This prints each registered species, its Bowtie2 index location, whether the index files are present on disk, the --species flag to use, and the current default parameters.

Usage instructions

1) Prepare a FASTA file

designProbes reads the first FASTA record in the input file. Use designProbesBatch for multi-record inputs.

>MyTarget
ACGTACGTACGTACGTACGTACGTACGTACGT

2) Run probe design

Before running designProbes with genome masking (default), register a reference species with buildGenomeIndex or fetchMouseIndex. You can also supply --index directly or skip genome masking with --no-genomemask.

designProbes targets.fa --species mouse --channel B1 --output probes.tsv --idt probes.idt

Batch mode example:

designProbesBatch targets.fa --species mouse --channel B1 --output probes.tsv --idt probes.idt

To override the channel per record in batch mode, add channel= to the FASTA header:

>MyTarget channel=B2
ACGTACGTACGTACGTACGT

Common flags:

• --no-genomemask: skip Bowtie2 genome masking (faster, but no uniqueness check).
• --index /path/to/index: override the Bowtie2 index path.
• --tileSize 52, --minGC, --maxGC, --maxProbes: tune probe selection.

Outputs:

• Probe designs are written to --output (stdout by default).
• --idt writes an IDT-friendly TSV for ordering.
• Bowtie2 genome masking writes a SAM file named {targetName}.sam in the working directory.