HSeeker
HSeeker is a fast, cross-platform Python package for detecting H-DNA (intramolecular triplex DNA) and mirror repeat structures in genomic sequences. It ships a compiled C extension (_hdna.c) for core scanning performance.
Package: hseeker on PyPI
Table of Contents
- Biological Background
- Algorithm Overview
- Installation
- Quick Start
- Python API
- Command-Line Interface
- Output Format
- Parameter Reference
- Understanding the Results
- Performance Notes
- Development & Testing
- Benchmarks
- Citation
- License
1. Biological Background
H-DNA (also called intramolecular triplex DNA) forms when a single DNA strand folds back onto the Watson–Crick duplex and inserts into the major groove via Hoogsteen or reverse-Hoogsteen pairing. The result is a triple-helical structure over a local region of the duplex.
5'─────[left arm]─────[spacer]─────[right arm]─────3'
╲ (hinge) ╱
╲__triplex core___╱
Structural requirements
| Requirement | Rationale |
|---|---|
| Mirror repeat geometry | Both arms must be approximate reverse complements of each other (reading the sequence in the same 5′→3′ direction, the two halves mirror each other). |
| Compositional asymmetry (purity) | Stable H-DNA requires a dominantly purine (GA-rich) or dominantly pyrimidine (CT-rich) arm to enable Hoogsteen pairing. |
| Short spacer / hinge | Loops >10 bp introduce thermodynamic strain that precludes stable folding. Typical genomic H-DNA has spacers of 0–7 bp. |
| Arm length ≥ 6 bp | Shorter tracts lack the binding energy for stable triplex formation. |
Biological significance
H-DNA is found throughout eukaryotic and prokaryotic genomes and has been associated with:
- Transcription regulation — GA-rich mirror repeats in promoters modulate RNA Pol II stalling.
- Genomic instability — H-DNA structures are linked to DNA breakage and large-scale rearrangements.
- Epigenetic features — Triplex-forming regions are enriched at nucleosome-depleted regulatory elements.
- Human disease — Polypurine tracts implicated in cancer, neurodegenerative diseases, and trinucleotide expansion disorders.
2. Algorithm Overview
HSeeker implements a center-outward biologically informed heuristic that supports imperfect mirrors and compositional tolerance, enabling detection of biologically realistic H-DNA candidates.
How it works
- Candidate generation — For every position
ctr(potential center of the hinge) and every spacer lengthspfrom 0 tomaxspacer:- A left pointer starts at
ctrand moves left (toward 5′). - A right pointer starts at
ctr + sp + 1and moves right (toward 3′).
- A left pointer starts at
- Outward extension — At each step
k, the base pair(dna[left], dna[right])is compared:- If equal: mirror match.
- If different: mismatch counter is incremented.
- Arm composition (fraction GA or CT) is tracked continuously.
- Threshold evaluation — After every base pair beyond
minrep, the algorithm evaluates:
$$\text{mirror identity} = 1 - \frac{\text{mismatches}}{k}$$
$$\text{purity} = \max!\left(\frac{\text{GA count}}{k},\ \frac{\text{CT count}}{k}\right)$$
If both $\text{mirror identity} \geq 1 - \texttt{mismatch}$ and $\text{purity} \geq \texttt{purity}$, the current arm length is recorded as a valid candidate.
- Longest-arm retention — For each
(ctr, sp)pair, only the longest valid arm is kept. This ensures no redundant shorter arms at the same position. - Overlap removal — After scanning the full sequence, overlapping hits are resolved by keeping the longest arm first; ties are broken by shorter spacer.
is_perfect classification
A hit is classified as is_perfect = True only when:
- The arm is 100% pure (either all GA or all CT), and
- The mirror identity is 100% (zero mismatches).
3. Installation
From PyPI (recommended)
pip install hseeker
Binary wheels are provided for CPython 3.9, 3.10, 3.11, 3.12, and 3.13 on Linux (x86_64, aarch64), macOS (x86_64, arm64, universal2), and Windows (AMD64). No compiler is needed.
From source
git clone https://github.com/Georgakopoulos-Soares-lab/HDNAhunter.git
cd HDNAhunter
pip install .
A C compiler (GCC, Clang, or MSVC) is required when building from source. The C extension compiles automatically during pip install.
Development install
pip install -e ".[dev]"
This installs pytest, build, twine, and cibuildwheel in addition to the package itself.
Dependencies
| Package | Version | Purpose |
|---|---|---|
| Python | 3.9–3.13 | Core runtime |
| pandas | ≥ 1.5 | DataFrame output helper |
4. Quick Start
In Python
import hseeker
# Scan a raw sequence string
hits = hseeker.scan_sequence(
"GGGAAAGGGTTTTCCCAAACCC",
minrep=10,
maxspacer=10,
purity=0.90,
mismatch=0.10,
)
for h in hits:
print(h["start"], h["end"], h["arm_length"], h["is_perfect"], h["total_score"])
# Scan an entire FASTA file (all hits collected into a list)
hits = hseeker.scan_fasta("genome.fa", minrep=10, purity=0.90)
# Memory-efficient streaming alternative — yields one hit at a time
for hit in hseeker.scan_fasta_iter("genome.fa", minrep=10, purity=0.90):
print(hit["seq_id"], hit["start"], hit["end"])
# Multi-core parallel scan — all chromosomes scanned concurrently
hits = hseeker.scan_fasta_parallel("genome.fa", minrep=10, purity=0.90)
hits = hseeker.scan_fasta_parallel("genome.fa", minrep=10, workers=4)
From the command line
# Minimal — scan test.fa and write test_HDNA.tsv
hseeker -seq test.fa -out test
# Strict mode — exact mirror, 100 % pure
hseeker -seq genome.fa -out strict -purity 1.0 -mismatch 0.0
# Relaxed mode — allow up to 10 % mismatch, 90 % purity
hseeker -seq genome.fa -out relaxed -purity 0.90 -mismatch 0.10
# Verbose output, longer arms only
hseeker -seq genome.fa -out long -minrep 10 -maxrep 1000 -v
5. Python API
hseeker.scan_sequence
hseeker.scan_sequence(
seq: str,
*,
minrep: int = 10,
maxrep: int = 1000,
maxspacer: int = 10,
purity: float = 0.90,
mismatch: float = 0.10,
remove_overlaps: bool = True,
seq_offset: int = 1,
score: bool = True,
) -> list[dict]
Scan a single DNA string for H-DNA mirror repeat motifs. The C core runs with the Python GIL released, so other threads remain unblocked during the scan.
Parameters — see Parameter Reference.
Returns a list of hit dictionaries. Each dictionary contains all fields described in Output Format.
hseeker.scan_fasta
hseeker.scan_fasta(
path: str | Path,
*,
minrep: int = 10,
maxrep: int = 1000,
maxspacer: int = 10,
purity: float = 0.90,
mismatch: float = 0.10,
remove_overlaps: bool = True,
score: bool = True,
) -> list[dict]
Scan every record in a FASTA file. Adds a seq_id key to each hit dict. Genomic offsets are parsed automatically from UCSC/Ensembl-style headers (>seqid:start-end); other headers default to offset 1.
hseeker.scan_fasta_iter
hseeker.scan_fasta_iter(
path: str | Path,
*,
minrep: int = 10,
maxrep: int = 1000,
maxspacer: int = 10,
purity: float = 0.90,
mismatch: float = 0.10,
remove_overlaps: bool = True,
score: bool = True,
) -> Generator[dict, None, None]
Streaming alternative to scan_fasta. Yields one hit dict at a time, keeping only a single record's worth of hits in memory at any moment. Use this for large FASTA files (e.g. whole-genome scans).
hseeker.scan_fasta_parallel
hseeker.scan_fasta_parallel(
path: str | Path,
*,
minrep: int = 10,
maxrep: int = 1000,
maxspacer: int = 10,
purity: float = 0.90,
mismatch: float = 0.10,
remove_overlaps: bool = True,
workers: int | None = None,
chunk_size: int = 1_000_000,
score: bool = True,
) -> list[dict]
Scans all FASTA records in parallel using a thread pool. Because the C scan releases the GIL, threads achieve true CPU parallelism on the heavy computation.
Records longer than chunk_size are split into overlapping chunks and scanned in
parallel. With the default chunk_size=1_000_000, even single-chromosome genomes
like E. coli (4.6 Mb) are split into multiple chunks for thread-level parallelism.
On a 5-core machine this achieves ~4.6× speedup over the sequential scan on
a single-chromosome genome.
workers defaults to os.cpu_count(). Pass an explicit integer to cap thread
count (e.g. workers=4). Results are returned in the same record order as the
input FASTA file.
6. Command-Line Interface
hseeker -seq <FASTA> -out <PREFIX> [options]
or equivalently:
python -m hseeker -seq <FASTA> -out <PREFIX> [options]
Positional / required arguments
| Argument | Description |
|---|---|
-seq FASTA |
Path to the input FASTA file. May contain one or multiple records. Both single-line and wrapped FASTA are supported. |
-out PREFIX |
Output file prefix. The tool writes <PREFIX>_HDNA.tsv. |
All optional arguments
| Argument | Type | Default | Description |
|---|---|---|---|
-minrep INT |
int | 10 |
Minimum arm length in base pairs. Arms shorter than this are not reported, even if they satisfy all other criteria. Increasing this value reduces noise and focuses on longer, likely more stable motifs. |
-maxrep INT |
int | 1000 |
Maximum arm length cap. The algorithm stops extending an arm beyond this length. Set higher for repetitive regions; setting it very high increases runtime without improving signal in most genomes. |
-maxspacer INT |
int | 10 |
Maximum spacer / hinge loop length in base pairs. The spacer is the single-stranded loop between the two mirror arms. H-DNA with spacers > 10 bp is thermodynamically unfavoured. |
-purity FLOAT |
float | 0.90 |
Minimum compositional purity of each arm (0.0–1.0). The arm must be ≥ purity fraction GA (purine) or ≥ purity fraction CT (pyrimidine). Set to 1.0 for perfect purine or pyrimidine tracts. |
-mismatch FLOAT |
float | 0.10 |
Maximum mirror mismatch fraction (0.0–1.0). Fraction of base positions in the arm where dna[left] ≠ dna[right] (i.e. the mirror is broken). 0.0 requires perfect mirror symmetry; 0.10 allows up to 10 % divergence. |
-skipoverlap |
flag | (off) | Skip overlap removal. By default, overlapping hits are collapsed to the longest arm (ties broken by shortest spacer). Pass this flag to disable overlap removal (useful for downstream ML or analysis). |
-score |
flag | (on) | Apply thermodynamic stability scoring. Enables stacking and pairing score computation for each hit. Pass -no-score to disable and keep only the core detection columns. |
-workers INT |
int | (all cores) | Parallel worker threads. The CLI uses scan_fasta_parallel internally and defaults to all available CPU cores. Set this to a lower value to cap CPU usage. |
-v |
flag | (off) | Verbose mode. Prints progress information to stderr. Useful for monitoring large jobs. |
CLI examples
# 1. Basic scan
hseeker -seq genome.fa -out results
# 2. Strict mode — exact mirror, 100 % pure
hseeker -seq genome.fa -out strict -purity 1.0 -mismatch 0.0
# 3. Whole-genome scan with minimum arm length 10 for high confidence
hseeker -seq hg38.fa -out hg38_hdna -minrep 10 -purity 0.85 -v
# 4. Exploratory scan — very permissive, keep all raw hits
hseeker -seq region.fa -out explore -purity 0.80 -mismatch 0.20 \
-minrep 8 -maxspacer 10 -skipoverlap
# 5. Long perfect H-DNA only
hseeker -seq genome.fa -out perfect -purity 1.0 -mismatch 0.0 \
-minrep 12 -maxspacer 3
# 6. Verbose output to monitor progress on a large genome
hseeker -seq hg38.fa -out hg38 -minrep 8 -v 2>progress.log
# 7. Use 8 worker threads instead of all cores
hseeker -seq hg38.fa -out hg38 -workers 8
7. Output Format
The CLI writes a tab-separated file (<prefix>_HDNA.tsv). scan_fasta() returns the same data as a list of dictionaries. Column descriptions:
| Column | Type | Description |
|---|---|---|
seq_id |
str | FASTA record identifier |
source |
str | Always findHDNA (for GFF3 / database compatibility) |
start |
int | 1-based, inclusive genomic start of the left arm |
end |
int | 1-based, inclusive genomic end of the right arm |
arm_length |
int | Length of each arm in bp (both arms are always equal length) |
spacer_length |
int | Length of the hinge loop between the two arms in bp |
total_length |
int | arm_length × 2 + spacer_length — full motif span |
ga_pct |
float | Percentage of G+A (purine) bases in the right arm (0–100) |
ct_pct |
float | Percentage of C+T (pyrimidine) bases in the right arm (0–100) |
mirror_identity |
float | Fraction of mirror positions that match × 100 (0–100) |
is_perfect |
bool | True if arm is 100 % pure and mirror identity is 100 % |
left_arm |
str | Sequence of the left arm (5′→3′) |
spacer |
str | Sequence of the hinge loop |
right_arm |
str | Sequence of the right arm (5′→3′) |
full_sequence |
str | Complete motif sequence: left_arm + spacer + right_arm |
stacking_score |
float | Stacking energy score from the triplex stability model (None if scoring was disabled) |
pairing_score |
float | Pairing energy score from the triplex stability model (None if scoring was disabled) |
total_score |
float | Combined stacking + pairing score (None if scoring was disabled) |
putative_triplex |
str | Adjusted triplex sequence in left_arm[spacer]right_arm notation after score-based boundary optimisation |
Example output
seq_id source start end arm_length spacer_length total_length ga_pct ct_pct mirror_identity is_perfect left_arm spacer right_arm full_sequence stacking_score pairing_score total_score putative_triplex
chr1 findHDNA 1001 1020 7 6 20 85.71 14.29 100.0 False gggaaat tttttt taaaggg gggaaattttttttaaaggg 35.0 42.3 77.3 gggaaa[tttttt]taaaggg
8. Parameter Reference
| Parameter | API name | CLI flag | Type | Default | Valid range | Notes |
|---|---|---|---|---|---|---|
| Minimum arm length | minrep |
-minrep |
int | 10 | ≥ 1 | Arms shorter than this are discarded entirely |
| Maximum arm length | maxrep |
-maxrep |
int | 1000 | ≥ minrep |
Hard cap on extension; rarely needs changing |
| Maximum spacer | maxspacer |
-maxspacer |
int | 10 | ≥ 0 | Set to 0 for zero-loop (adjacent arms) only |
| Purity threshold | purity |
-purity |
float | 0.90 | 0.0–1.0 | Fraction GA or CT required in arm |
| Mismatch tolerance | mismatch |
-mismatch |
float | 0.10 | 0.0–1.0 | Fraction of arm positions allowed to mismatch the mirror |
| Overlap removal | remove_overlaps |
-skipoverlap (inverts) |
bool | True | — | When True, keeps only the longest non-overlapping hit |
| Sequence offset | seq_offset |
(automatic in CLI) | int | 1 | ≥ 1 | 1-based start coordinate of seq[0]; used for correct genomic coordinates |
| Worker threads | (CLI only) | -workers |
int | all cores | ≥ 1 | Number of parallel threads used by the CLI (via scan_fasta_parallel) |
| Stability scoring | score |
-score / -no-score |
bool | True | — | When True, computes stacking and pairing scores and an optimised triplex sequence for each hit. Scoring adds stacking_score, pairing_score, total_score, and putative_triplex columns. |
Choosing parameters for your use case
Genome-wide survey (high confidence)
minrep=10, maxrep=1000, maxspacer=10, purity=0.90, mismatch=0.10
Exploratory / maximum sensitivity
minrep=8, maxrep=1000, maxspacer=10, purity=0.80, mismatch=0.20
Downstream ML or statistical analysis (all raw candidates)
remove_overlaps=False, skipoverlap (CLI)
9. Understanding the Results
Interpreting ga_pct and ct_pct
These two values always sum to ≤ 100 %. The difference is due to ambiguous or masked bases:
- GA-rich arm (
ga_pct ≈ 80–100): purine-rich tract → H-r triplex (Pu·Pu·Py) - CT-rich arm (
ct_pct ≈ 80–100): pyrimidine-rich tract → H-y triplex (Py·Pu·Py) - Mixed (
neither > purity): filtered out unlesspurityis set very low
mirror_identity vs purity
mirror_identity measures how closely the two arms are mirror images of each other. A value of 100 means every base on the left arm is identical to its mirror partner on the right arm. A value of 90 means 10 % of positions have a mismatch. purity, by contrast, measures the fraction of the arm that is GA-rich or CT-rich, regardless of the mirror match.
is_perfect flag
is_perfect = True is a stringent classification reserved for hits that are both:
- 100 % pure — every base in the arm is GA, or every base is CT.
- 100 % mirror-symmetric — no mismatches between the two arms.
These are the most likely candidates for stable H-DNA structures.
Scoring results (stacking_score, pairing_score, total_score)
When scoring is enabled (default), each hit is passed through a thermodynamic stability model that evaluates the energetic favourability of triplex formation. The model assigns a pairing score (based on hydrogen bonding interactions) and a stacking score (base-stacking interactions), summed to give total_score. Higher scores indicate stronger predicted stability.
The scoring pass also produces a putative_triplex field — the motif sequence in left_arm[spacer]right_arm notation — whose arm/spacer boundaries may differ from the original detection because scoring re-optimises the boundaries within a local window to maximise predicted stability.
Scoring can be disabled at the API level (score=False) or via the CLI flag -no-score, which removes the four scoring columns from the TSV output.
Overlap removal behaviour
When remove_overlaps=True (default), two hits overlap if their genomic ranges on the DNA share at least one base. Among all overlapping hits, the one with the longest arm is retained. Ties are broken by shorter spacer. This keeps the most confident candidates and avoids redundant reporting of the same structural feature detected at slightly different boundaries.
10. Performance Notes
- The C extension releases the Python GIL during scanning, enabling multi-threaded use.
scan_fasta_parallel(path, workers=N)with defaultchunk_size=1_000_000achieves ~N× speedup on N-core machines even for single-chromosome genomes like E. coli (4.6 Mb), which are automatically split into overlapping chunks.- The CLI uses
scan_fasta_parallelby default, automatically parallelising across all available CPU cores. A single human chromosome (≈ 250 Mb, chr1) processes in ~78 seconds on 16 cores. Use-workers Nto limit parallelism. - The internal hit buffer is capped at 1,000,000 hits per
scan_sequencecall. For whole-genome scans, usescan_fasta_parallel(which splits each contig into overlapping chunks) rather than concatenating chromosomes into a single string. - Memory usage is approximately O(n_hits × 200 bytes) plus the sequence string itself.
- N bases in the sequence (
N,n) break arm extension, as per the original algorithm.
11. Development & Testing
Running the test suite
# Install dev dependencies first
pip install -e ".[dev]"
# Run all 134 tests
pytest -v tests/
The test suite (tests/test_hdna.py) covers:
- Empty / trivial inputs
- Known GA and CT mirror motifs with exact expected values
- Strict mode (purity=1.0, mismatch=0.0) and relaxed mode
- Coordinate offset propagation (
seq_offset) - Multi-record FASTA parsing,
scan_fasta_iterstreaming generator, andscan_fasta_parallel - Parallel chunking edge cases: boundary hits, tiny chunks, N-bases near boundaries, determinism
- Overlap removal correctness
- Parameter validation (out-of-range inputs)
- Exact field values for reference sequences
- Purity and maxspacer boundary conditions
- Case insensitivity (mixed-case input)
- Output field self-consistency (
start + total_length - 1 == end) - Flanking N base handling
is_perfectflag logic- Mirror identity with known mismatch counts
- Determinism (identical calls produce identical results)
- CLI end-to-end integration
Project structure
hseeker/
├── src/
│ └── hseeker/
│ ├── _hdna.c # C extension — core algorithm
│ ├── __init__.py # Python API (scan_sequence, scan_fasta, scan_fasta_iter, scan_fasta_parallel)
│ └── __main__.py # CLI entry point (hseeker / python -m hseeker)
├── tests/
│ └── test_hdna.py # 134 comprehensive tests (pytest)
├── .github/
│ └── workflows/
│ └── build_wheels.yml # CI: build binary wheels + sdist, publish to PyPI
├── pyproject.toml # Build config (setuptools, cibuildwheel, pytest)
├── setup.py # C extension definition
├── MANIFEST.in # sdist file inclusion rules
└── README.md
Building wheels locally
# Build the current platform wheel
pip install build
python -m build --wheel
# Build all platform wheels (requires Docker on Linux/Windows)
pip install cibuildwheel
cibuildwheel --platform linux
Adding a new test
Tests live in tests/test_hdna.py. Each section focuses on one concern. Add new sequences as module-level constants and group related assertions under a descriptively named function. Run pytest -v tests/ to validate.
12. Benchmarks
benchmarks/benchmark.py is a CLI-only end-to-end benchmark that downloads real
hg38/GRCh38 chromosomes from NCBI and measures wall time, peak RSS, and TSV
throughput for the full hseeker pipeline (FASTA read → scan → overlap removal
→ scoring → TSV write).
Setup
pip install -e ".[dev]"
Running
# All 24 chromosomes (~3 GB download on first run)
python benchmarks/benchmark.py
# Single chromosome quick test
python benchmarks/benchmark.py --chromosomes chr1
# Save machine-readable results to JSON
python benchmarks/benchmark.py --chromosomes chr1 --json results.json
# Write a Markdown report
python benchmarks/benchmark.py --chromosomes chr1 --report report.md
# Force re-download
python benchmarks/benchmark.py --no-cache
Chromosome FASTA files are cached in benchmarks/data/ (gitignored).
When chr1, chr2, and chr3 are all present, the benchmark automatically
builds a concatenated chr1_2_3.fa for multi-record throughput testing.
13. Citation
If you use HSeeker in published research, please cite:
Georgakopoulos-Soares Lab, UT Austin.
HSeeker: fast, cross-platform detection of H-DNA and mirror repeat structures in genomic sequences.
https://github.com/Georgakopoulos-Soares-lab/HDNAhunter
14. License
MIT License — see LICENSE for full text.
Copyright © 2024 Georgakopoulos-Soares Lab, UT Austin.
Metadata
Release files for hseeker 0.1.1
For a detailed explanation of source distributions (sdists) and built distributions (wheels), please see the package formats documentation.
Source distribution (sdist)
| File | Size | Uploaded | |
|---|---|---|---|
| hseeker-0.1.1.tar.gz | 56.2 kB | Details |
Built distributions (wheels)
Total release size: 1.4 MB
Release files / hseeker-0.1.1.tar.gz
| Download URL | hseeker-0.1.1.tar.gz |
|---|---|
| Size | 56.2 kB |
| Tags | Source |
|
SHA-256 checksum How to use checksums |
3d9a1fd9a7fd1d7e73a02e6b1e6853f38655428d2033503eed9af3244ae7e8f7
|
|
BLAKE2b-256 checksum How to use checksums |
ca1a289c61644eb9fcea2af1801d04f375e5e1db130347768aa021d2494c096a
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.13.12
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jun 25, 2026.
Transparency logRelease files / hseeker-0.1.1-cp312-cp312-win_amd64.whl
| Download URL | hseeker-0.1.1-cp312-cp312-win_amd64.whl |
|---|---|
| Size | 47.6 kB |
| Tags | CPython 3.12 Windows x86-64 |
|
SHA-256 checksum How to use checksums |
c0d94507b720dd69d77de25db3c418b2b089f8d055fbca5a35dbba1cbd9e544a
|
|
BLAKE2b-256 checksum How to use checksums |
7b2a9b2741384168fe118e7486803445e6cad993d7a74b4dcf6427333963d602
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.13.12
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jun 25, 2026.
Transparency logRelease files / hseeker-0.1.1-cp312-cp312-manylinux_2_17_aarch64.manylinux2014_aarch64.whl
| Download URL | hseeker-0.1.1-cp312-cp312-manylinux_2_17_aarch64.manylinux2014_aarch64.whl |
|---|---|
| Size | 68.5 kB |
| Tags | CPython 3.12 Linux glibc 2.17+ ARM64 |
|
SHA-256 checksum How to use checksums |
289ea5fbcf94de1d903a48ee0b523f61787164b2b6620e10cf9fe3ebadaa9cca
|
|
BLAKE2b-256 checksum How to use checksums |
df1a4e06a169a6b63bb6a5bbc20be62cd2d0cc43c4659aadf02954cc317cccfc
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.13.12
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jun 25, 2026.
Transparency logRelease files / hseeker-0.1.1-cp312-cp312-manylinux_2_5_x86_64.manylinux1_x86_64.manylinux_2_17_x86_64.manylinux2014_x86_64.whl
| Download URL | hseeker-0.1.1-cp312-cp312-manylinux_2_5_x86_64.manylinux1_x86_64.manylinux_2_17_x86_64.manylinux2014_x86_64.whl |
|---|---|
| Size | 68.9 kB |
| Tags | CPython 3.12 Linux glibc 2.17+ x86-64 Linux glibc 2.5+ x86-64 |
|
SHA-256 checksum How to use checksums |
5330cba6315a2870b1c5caeb8229e930f1cd2fee64a41a61485cf96b64999162
|
|
BLAKE2b-256 checksum How to use checksums |
be5fb10897f2bc1cf733ab888b462370a1745c02e46f6eef0a26329cabc2838f
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.13.12
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jun 25, 2026.
Transparency logRelease files / hseeker-0.1.1-cp312-cp312-macosx_11_0_arm64.whl
| Download URL | hseeker-0.1.1-cp312-cp312-macosx_11_0_arm64.whl |
|---|---|
| Size | 45.2 kB |
| Tags | CPython 3.12 macOS 11.0+ ARM64 |
|
SHA-256 checksum How to use checksums |
b7e3ad025a6707f6ee4ca5e9e6e2bbd39202019f1b50e0b143e2f703bff89df0
|
|
BLAKE2b-256 checksum How to use checksums |
065470a849dbf0b4761c3f17eda4f40240fb2b31c5ca4730eafcb50d82b6540c
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.13.12
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jun 25, 2026.
Transparency logRelease files / hseeker-0.1.1-cp312-cp312-macosx_10_9_x86_64.whl
| Download URL | hseeker-0.1.1-cp312-cp312-macosx_10_9_x86_64.whl |
|---|---|
| Size | 45.0 kB |
| Tags | CPython 3.12 macOS 10.9+ x86-64 |
|
SHA-256 checksum How to use checksums |
e68780070c93d6b067d455a7e2f9597383577b5bbe449ef5184a4615b33e8364
|
|
BLAKE2b-256 checksum How to use checksums |
59a08c89ca33b51b7ae995bd6f2ec8c826f40859068a00b4a512ca997a215bbc
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.13.12
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jun 25, 2026.
Transparency logRelease files / hseeker-0.1.1-cp312-cp312-macosx_10_9_universal2.whl
| Download URL | hseeker-0.1.1-cp312-cp312-macosx_10_9_universal2.whl |
|---|---|
| Size | 52.3 kB |
| Tags | CPython 3.12 macOS 10.9+ universal2 (ARM64, x86-64) |
|
SHA-256 checksum How to use checksums |
b9c0c44ea86c69300dee002528fc106350e85923dcfc5b37175959f4048a2463
|
|
BLAKE2b-256 checksum How to use checksums |
78b12bc5452a9cbc589693516fc0317a6fe70edd8ca1280a65419428c17fd38f
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.13.12
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jun 25, 2026.
Transparency logRelease files / hseeker-0.1.1-cp311-cp311-win_amd64.whl
| Download URL | hseeker-0.1.1-cp311-cp311-win_amd64.whl |
|---|---|
| Size | 47.6 kB |
| Tags | CPython 3.11 Windows x86-64 |
|
SHA-256 checksum How to use checksums |
f3fa49f8ed1025a8b983d2a20aa52f51c37fab5cddc7a39757304e1c5e76684b
|
|
BLAKE2b-256 checksum How to use checksums |
a5a4129229501e200bdbdfbd494e5806db918b5f48e6aa771a73240e45253085
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.13.12
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jun 25, 2026.
Transparency logRelease files / hseeker-0.1.1-cp311-cp311-manylinux_2_17_aarch64.manylinux2014_aarch64.whl
| Download URL | hseeker-0.1.1-cp311-cp311-manylinux_2_17_aarch64.manylinux2014_aarch64.whl |
|---|---|
| Size | 68.4 kB |
| Tags | CPython 3.11 Linux glibc 2.17+ ARM64 |
|
SHA-256 checksum How to use checksums |
6b55f21dc6108b9a491fab08475af39cae9a4b49c28145c5b97cb634e0d47538
|
|
BLAKE2b-256 checksum How to use checksums |
24cdcdad1031859bcc90d754d37249aca4bc6a4aa2ee081f04419df53e87acbd
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.13.12
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jun 25, 2026.
Transparency logRelease files / hseeker-0.1.1-cp311-cp311-manylinux_2_5_x86_64.manylinux1_x86_64.manylinux_2_17_x86_64.manylinux2014_x86_64.whl
| Download URL | hseeker-0.1.1-cp311-cp311-manylinux_2_5_x86_64.manylinux1_x86_64.manylinux_2_17_x86_64.manylinux2014_x86_64.whl |
|---|---|
| Size | 68.8 kB |
| Tags | CPython 3.11 Linux glibc 2.17+ x86-64 Linux glibc 2.5+ x86-64 |
|
SHA-256 checksum How to use checksums |
40b16fa3645a7144041d2e0590e4a1d8e3e2c9a1c198a53405239085fd3b6d9f
|
|
BLAKE2b-256 checksum How to use checksums |
9c174799427a71aa2e45349e3308b1a11c2f5ad558530b0bbc1a2aff46f5822f
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.13.12
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jun 25, 2026.
Transparency logRelease files / hseeker-0.1.1-cp311-cp311-macosx_11_0_arm64.whl
| Download URL | hseeker-0.1.1-cp311-cp311-macosx_11_0_arm64.whl |
|---|---|
| Size | 45.2 kB |
| Tags | CPython 3.11 macOS 11.0+ ARM64 |
|
SHA-256 checksum How to use checksums |
c3c713182e14b6902afaee17e84f88d59a4ef7d66d4b097367822ef201a2b54b
|
|
BLAKE2b-256 checksum How to use checksums |
b091b73c7ad99117cb4282845a98baae65bf0d52b604278f3c5760cccded68e7
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.13.12
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jun 25, 2026.
Transparency logRelease files / hseeker-0.1.1-cp311-cp311-macosx_10_9_x86_64.whl
| Download URL | hseeker-0.1.1-cp311-cp311-macosx_10_9_x86_64.whl |
|---|---|
| Size | 45.1 kB |
| Tags | CPython 3.11 macOS 10.9+ x86-64 |
|
SHA-256 checksum How to use checksums |
e0218c5ca24945ceb52629ff0f65bbab0eafa58de6a2c79976bfafd3a17b20ba
|
|
BLAKE2b-256 checksum How to use checksums |
e2bae9904dc35ad7a3b7e84307a404ae21295e60a35143c7f87da44520e57d10
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.13.12
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jun 25, 2026.
Transparency logRelease files / hseeker-0.1.1-cp311-cp311-macosx_10_9_universal2.whl
| Download URL | hseeker-0.1.1-cp311-cp311-macosx_10_9_universal2.whl |
|---|---|
| Size | 52.4 kB |
| Tags | CPython 3.11 macOS 10.9+ universal2 (ARM64, x86-64) |
|
SHA-256 checksum How to use checksums |
2b67c7f9464d6a33202b6fbcc4f7c8fb69af717c07d1804c22fd2bdb94a74a69
|
|
BLAKE2b-256 checksum How to use checksums |
2aeec66f565924de61c7aa2ff6b135fc4e2391e1927f8e814ba70de1505a6fb5
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.13.12
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jun 25, 2026.
Transparency logRelease files / hseeker-0.1.1-cp310-cp310-win_amd64.whl
| Download URL | hseeker-0.1.1-cp310-cp310-win_amd64.whl |
|---|---|
| Size | 47.5 kB |
| Tags | CPython 3.10 Windows x86-64 |
|
SHA-256 checksum How to use checksums |
a24bd0df2dffb56fa13897d4a1b9d06e12b68e15bbca0eab59c96ddda55334d8
|
|
BLAKE2b-256 checksum How to use checksums |
71d45de7c9130b0bb45b24dd70c62c4e793bf913f3fbc16f23d4f63007683745
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.13.12
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jun 25, 2026.
Transparency logRelease files / hseeker-0.1.1-cp310-cp310-manylinux_2_17_aarch64.manylinux2014_aarch64.whl
| Download URL | hseeker-0.1.1-cp310-cp310-manylinux_2_17_aarch64.manylinux2014_aarch64.whl |
|---|---|
| Size | 67.4 kB |
| Tags | CPython 3.10 Linux glibc 2.17+ ARM64 |
|
SHA-256 checksum How to use checksums |
fffb047ef78be54ae6fad325658f78f47e9253740a414942fbb579e329a061d4
|
|
BLAKE2b-256 checksum How to use checksums |
fd67da00407e67ed994d623ecb8e67aaa2e5d97cd1a35c17b3b6bfc6cbd5df1a
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.13.12
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jun 25, 2026.
Transparency logRelease files / hseeker-0.1.1-cp310-cp310-manylinux_2_5_x86_64.manylinux1_x86_64.manylinux_2_17_x86_64.manylinux2014_x86_64.whl
| Download URL | hseeker-0.1.1-cp310-cp310-manylinux_2_5_x86_64.manylinux1_x86_64.manylinux_2_17_x86_64.manylinux2014_x86_64.whl |
|---|---|
| Size | 67.8 kB |
| Tags | CPython 3.10 Linux glibc 2.17+ x86-64 Linux glibc 2.5+ x86-64 |
|
SHA-256 checksum How to use checksums |
e517e5307dc15267390f92bfb26b9244e4910be226a9ecf18f458f87ec676d4c
|
|
BLAKE2b-256 checksum How to use checksums |
97559f0b3324b919ae3eb9b1b49c38acb0ae3a2932a0516dc47133754349b7ad
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.13.12
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jun 25, 2026.
Transparency logRelease files / hseeker-0.1.1-cp310-cp310-macosx_11_0_arm64.whl
| Download URL | hseeker-0.1.1-cp310-cp310-macosx_11_0_arm64.whl |
|---|---|
| Size | 45.2 kB |
| Tags | CPython 3.10 macOS 11.0+ ARM64 |
|
SHA-256 checksum How to use checksums |
3af0ca9d9b964ee252a8ba337f1537c10add7b5711b18fc8b6c7c112b0d334ff
|
|
BLAKE2b-256 checksum How to use checksums |
f0a5a94fb6fa84070cb10e688a7b20e7a47904c2b28fc37615b0c0f5e4ff0159
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.13.12
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jun 25, 2026.
Transparency logRelease files / hseeker-0.1.1-cp310-cp310-macosx_10_9_x86_64.whl
| Download URL | hseeker-0.1.1-cp310-cp310-macosx_10_9_x86_64.whl |
|---|---|
| Size | 45.1 kB |
| Tags | CPython 3.10 macOS 10.9+ x86-64 |
|
SHA-256 checksum How to use checksums |
6657c440dbb9cab7f1a78757a1c9f5ff1ef38d7e2378f3ea6fc21b012d8aea5a
|
|
BLAKE2b-256 checksum How to use checksums |
645de8be5b4e54c461108f3984edf4f9b228bead10c220a45571788bfeeb3321
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.13.12
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jun 25, 2026.
Transparency logRelease files / hseeker-0.1.1-cp310-cp310-macosx_10_9_universal2.whl
| Download URL | hseeker-0.1.1-cp310-cp310-macosx_10_9_universal2.whl |
|---|---|
| Size | 52.4 kB |
| Tags | CPython 3.10 macOS 10.9+ universal2 (ARM64, x86-64) |
|
SHA-256 checksum How to use checksums |
3739dca89848c30b1cca49641f010c144fc38ff073374d70a68582d0f2bb4bf0
|
|
BLAKE2b-256 checksum How to use checksums |
4611c306844648dfb45c86960c53d9c211d80b0f1625f8556bc1c4f29ac959cd
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.13.12
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jun 25, 2026.
Transparency logRelease files / hseeker-0.1.1-cp39-cp39-win_amd64.whl
| Download URL | hseeker-0.1.1-cp39-cp39-win_amd64.whl |
|---|---|
| Size | 47.5 kB |
| Tags | CPython 3.9 Windows x86-64 |
|
SHA-256 checksum How to use checksums |
ca94e8b4fdddc30eaeb465694fec04101498beb4c7e9c32d282cb6c651ae29b9
|
|
BLAKE2b-256 checksum How to use checksums |
d97e4a72765f836f41299b2f4ea9ab617a8822d06b7199085a853247a034af46
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.13.12
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jun 25, 2026.
Transparency logRelease files / hseeker-0.1.1-cp39-cp39-manylinux_2_17_aarch64.manylinux2014_aarch64.whl
| Download URL | hseeker-0.1.1-cp39-cp39-manylinux_2_17_aarch64.manylinux2014_aarch64.whl |
|---|---|
| Size | 67.2 kB |
| Tags | CPython 3.9 Linux glibc 2.17+ ARM64 |
|
SHA-256 checksum How to use checksums |
c2f81eb938e3aa8321cc78bcc1e2b0317304db37412b34bbbf821f2648eaa9a3
|
|
BLAKE2b-256 checksum How to use checksums |
ff2c2649e3030f4a44968e7d55f144db792cef5d6af9721d9f833beaa2b6fcd8
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.13.12
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jun 25, 2026.
Transparency logRelease files / hseeker-0.1.1-cp39-cp39-manylinux_2_5_x86_64.manylinux1_x86_64.manylinux_2_17_x86_64.manylinux2014_x86_64.whl
| Download URL | hseeker-0.1.1-cp39-cp39-manylinux_2_5_x86_64.manylinux1_x86_64.manylinux_2_17_x86_64.manylinux2014_x86_64.whl |
|---|---|
| Size | 67.6 kB |
| Tags | CPython 3.9 Linux glibc 2.17+ x86-64 Linux glibc 2.5+ x86-64 |
|
SHA-256 checksum How to use checksums |
a589f2bbfb0c57ea4980733f49ccc7af3dc4388b4d9e29a0c44251dbff23c275
|
|
BLAKE2b-256 checksum How to use checksums |
fdec3445d33b92aca7ab60fb21c0958b342cce09670502367bb17926a3a5cfcc
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.13.12
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jun 25, 2026.
Transparency logRelease files / hseeker-0.1.1-cp39-cp39-macosx_11_0_arm64.whl
| Download URL | hseeker-0.1.1-cp39-cp39-macosx_11_0_arm64.whl |
|---|---|
| Size | 45.2 kB |
| Tags | CPython 3.9 macOS 11.0+ ARM64 |
|
SHA-256 checksum How to use checksums |
7651cab1be132a61447a2b06283768a29021a0f9a1d139c2ad2ae9ef6ab73d40
|
|
BLAKE2b-256 checksum How to use checksums |
081f124dcd4108cf63aace72a7037feb78ae58f1d419fbc5f7caa526b9139633
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.13.12
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jun 25, 2026.
Transparency logRelease files / hseeker-0.1.1-cp39-cp39-macosx_10_9_x86_64.whl
| Download URL | hseeker-0.1.1-cp39-cp39-macosx_10_9_x86_64.whl |
|---|---|
| Size | 45.1 kB |
| Tags | CPython 3.9 macOS 10.9+ x86-64 |
|
SHA-256 checksum How to use checksums |
9ada46f1be956935eda06674503377d8ddd0595a98814fc75e7d10d229bf7d69
|
|
BLAKE2b-256 checksum How to use checksums |
ce15544e1700516e50c6853b8cd38f9f68c0ee7c6a6ee4a7e39a38cc1267fb66
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.13.12
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jun 25, 2026.
Transparency logRelease files / hseeker-0.1.1-cp39-cp39-macosx_10_9_universal2.whl
| Download URL | hseeker-0.1.1-cp39-cp39-macosx_10_9_universal2.whl |
|---|---|
| Size | 52.4 kB |
| Tags | CPython 3.9 macOS 10.9+ universal2 (ARM64, x86-64) |
|
SHA-256 checksum How to use checksums |
d0104e2b9b531b66ed93822d13717dfc7bc956e19d6d37b5a1ffc1add1478c54
|
|
BLAKE2b-256 checksum How to use checksums |
fbffeba32988d106a55b63eb7fb2b44bca108ced36ad1fc30892abf4005232f6
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/6.1.0 CPython/3.13.12
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Jun 25, 2026.
Transparency log