Tree reconstruction of ancestry using incomplete lineage sorting
Project description
iTRAILS
Software
iTRAILS is a framework to jointly model incomplete lineage sorting (ILS) and gene flow (GF). iTRAILS uses the multispecies coalescent to approximate the ancestral recombination history of three populations and an outgroup. In brief, iTRAILS infers the ancestral tree from a multiple genome alignment, unbiasedly estimating ancestral effective population sizes, speciation times, and introgression time and proportions. iTRAILS also performs posterior decoding.
iTRAILS can be installed as both a PyPi and a conda package, and it's codebase is available at:
https://github.com/trails-phylogeny/itrails
Once the package is installed, iTRAILS is initiaited and controlled through 2 main console commands.
Optimization of Parameters
iTRAILS estimates key demographic parameters—such as speciation times, ancestral effective population sizes (Ne), and recombination rate (ρ)—by maximizing the log-likelihood computed from the coalescent HMM. iTRAILS takes into account the following parameters:
- Population size parameters:
- N_AB: Effective size of the ancestral population between the two most closely related species.
- N_ABC: Effective size of the ancestral population between the three species.
- Time parameters (generations):
- T_1: Assuming ultrametric model, time from sample to coalescence of species A and B.
- T_2: Time between coalescence of species A and B and coalescence of AB ancestral with species C.
- T_3: Time between coalescence of species ABC and coalescence of ABC ancestral with outgroup species.
- T_A: Time from sample of species A until coalescence with species B.
- T_B: Time from sample of species B until coalescence with species A.
- T_C: Time from sample of species C until coalescence with AB ancestral.
- T_Upper: Time from start of last discretized time interval in ABC ancestral until coalescence with outgroup.
- T_Out: Time from sample of outgorup until coalescence with ABC ancestral.
- Other parameters:
- Recombination rate (ρ): NUmber of recombinations per site per generation.
- Mutation rate (μ): Number of mutations per site per generation.
Not all of the previously described parameters are independent from each other. Therefore, definition of parameters should comply with the following restrictions:
- T_2, N_AB, N_ABC, ρ must always be defined as a fixed parameter os as a parameter to optimize.
- μ must always be defined as a fixed parameter.
- T_Upper and T_3: At least one of them should be defined (fixed or optimized). If only one of them is defined, the other one will be automatically calculated.
- T_out: Can be defined or omitted, if defined it must be fixed, if omitted it will be automatically calculated.
- T_A, T_B, T_C and T_1 should be defined (fixed or optimized) in the following combinations, the non defined parameters will take values as defined in the following table:
| Specified parameters | Used T_A | Used T_B | Used T_C |
|---|---|---|---|
| T_A / T_B / T_C | T_A | T_B | T_C |
| T_1 / T_A | T_A | T_1 | T_1 + T_2 |
| T_1 / T_B | T_1 | T_B | T_1 + T_2 |
| T_1 / T_C | T_1 | T_1 | T_C |
| T_A / T_B | T_A | T_B | $\frac{T_A + T_B}{2} + T_2$ |
| T_A / T_C | T_A | $\frac{T_A + T_C - T_2}{2}$ | T_C |
| T_B / T_C | $\frac{T_B + T_C - T_2}{2}$ | T_B | T_C |
| T_1 | T_1 | T_1 | T_1 + T_2 |
In order to run an optimization, iTRAILS needs two input files.
- A four-way genome alignment (MAF file) between three species and an outgroup.
$ cat alignment.maf
##maf version=1 scoring=none
# generated by Biopython
a score=3.25073e+06
s gorGor5.CYUI01015145v1 8162515 3382 + 8455952 tcaaaaaactatttcttgagcattcattaagtgcaaa
s hg38.chr1 24998515 3414 + 248956422 TCAAAAAACTATTTCTTGAGCATTCATTAAGTGCAAA
s panTro5.chr1 24190887 3415 + 228573443 tcaaaaaactatctcttgagcattcattaagtgcaaa
s ponAbe2.chr1 24531025 3415 - 229942017 tcaaaaaactctttcttgagcattcattaagtgcaaa
a score=4.56614e+06
- A configuration file (.yaml) that specifies fixed parameters, parameters to optimize, as well as the alignment file path (optional) and output path (optional). An example configuration file is found in the package and can be seen in console with the following function:
Project details
Release history Release notifications | RSS feed
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
Built Distribution
Filter files by name, interpreter, ABI, and platform.
If you're not sure about the file name format, learn more about wheel file names.
Copy a direct link to the current filters
File details
Details for the file itrails-1.0.0.tar.gz.
File metadata
- Download URL: itrails-1.0.0.tar.gz
- Upload date:
- Size: 55.2 kB
- Tags: Source
- Uploaded using Trusted Publishing? No
- Uploaded via: twine/6.1.0 CPython/3.12.9
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
9f943bd7195237388c72b36591b114a97b6b464ceeddb7d29bd77708a6d3225e
|
|
| MD5 |
e46293718af3425329b3083d8150f444
|
|
| BLAKE2b-256 |
92fceb008dd1943fa9367ca9ee69f1eee5637a71fdda30c159605582ca29fe78
|
File details
Details for the file itrails-1.0.0-py3-none-any.whl.
File metadata
- Download URL: itrails-1.0.0-py3-none-any.whl
- Upload date:
- Size: 58.7 kB
- Tags: Python 3
- Uploaded using Trusted Publishing? No
- Uploaded via: twine/6.1.0 CPython/3.12.9
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
4ec788a72439011fc75622f5cf2be7f455ed63acffbc9b043b3abcf418540a9c
|
|
| MD5 |
f6184b5f870112b90acf11a519e034f1
|
|
| BLAKE2b-256 |
f72303a71c147998e2f16b6337eb837fd5cfcaea1459634b6fa00d561f905f91
|