jsrc 0.3.1

Python library for bioinformatics and scientific computing

jsrc

Python library for bioinformatics and scientific computing.

Installation

Recommended (global CLI via uv tool):

uv tool install jsrc

Using uv virtual environment:

uv venv
source .venv/bin/activate
uv pip install jsrc

Using Conda virtual environment + pip:

conda create -n jsrc python=3.11 -y
conda activate jsrc
pip install jsrc

From source (development):

git clone https://github.com/imjiaoyuan/jsrc.git
cd jsrc
uv venv
uv sync --extra dev --extra all

Run jsrc --help to get started.

For detailed usage, see the Documentation. 中文文档请参阅 文档。

Quick Start

jsrc --help
jsrc <module> --help
jsrc <module> <subcommand> --help

Examples:

jsrc seq --help
jsrc analyze phylo --help
jsrc vision extract --help

Module Overview

module	focus	typical use
seq	Sequence extraction, translation, QC, k-mer, sliding window	jsrc seq extract ...
genome	Genome statistics, feature detection, comparative/evolutionary analysis	jsrc genome stats ...
plot	Gene/exon/chromosome/domain and other plots	jsrc plot gene ...
analyze	Phylogeny, motif, consensus, SNP/INDEL, QC	jsrc analyze phylo ...
grn	GRN conversion, centrality, build packaging, local serve	jsrc grn build ...
vision	Object extraction, morphology traits, EFD	jsrc vision extract ...
job	Background job submit/monitor/log/kill/gc	jsrc job submit "cmd"

Error Output Conventions

• Input and validation failures are reported in unified format: Error: <message>.
• Missing files, invalid parameters, and incompatible inputs follow the same style across subcommands.
• Use --help on the target module/subcommand first when argument combinations are unclear.

A Glance of jsrc's Functions

vision module

jsrc vision extract -i test/leaf1.jpg -o test/efd --channel a --invert --save-mask
jsrc vision efd -i test/efd -o test/efd --harmonics 20

Contour extraction & EFD reconstruction (20 harmonics):

EFD coefficients (first 5 rows):

an,bn,cn,dn
 0.7004,  0.0127, -0.0412,  1.0018
-0.0100, -0.0083, -0.0400,  0.0293
 0.0948, -0.0055, -0.0285, -0.1134
 0.0085, -0.0702,  0.0777, -0.0099

Morphological traits:

jsrc vision traits -i test/leaf1.jpg --channel a --invert

trait	value
area	461833.5
perimeter	3479.84
aspect_ratio	0.671
circularity	0.479
extent	0.535
solidity	0.837

---

grn module

Generate and launch a 1000-gene random network viewer:

jsrc grn net2json -i test/grn/network.tsv -o test/grn/grn.json
jsrc grn anno2json -i test/grn/annotation.tsv -o test/grn/annotation.json
jsrc grn build -d test/grn/public -g test/grn/grn.json -n test/grn/annotation.json -z test/grn/grn-viewer.zip -a -t 200
jsrc grn serve -d test/grn/public -g test/grn/public/json/grn.json -n test/grn/public/json/annotation.json -p 8000 -a -t 200

Centrality ranking (top 5):

jsrc grn centrality -i test/grn/network.tsv --top 5

rank	node	in_degree	out_degree	total_degree
1	GENE_0504	24.14	34.97	59.12
2	GENE_0785	26.37	29.51	55.88
3	GENE_0165	42.81	12.21	55.01
4	GENE_0394	14.82	33.04	47.86
5	GENE_0427	36.50	10.60	47.10

---

genome module

jsrc genome stats -fa genome.fa
jsrc genome cpg -fa genome.fa --window 200 --min-len 500
jsrc genome ani -fa1 genome1.fa -fa2 genome2.fa -k 21
jsrc genome codon -fa cds.fa --cai reference.fa --enc

Genome statistics: N50 2,450,000 bp, L50 3, GC 45.2%, 15 gaps.

CpG islands: 42 islands found, longest 1,250 bp.

ANI: 96.8% (Jaccard 0.85, Mash distance 0.032).

Codon usage: CAI 0.78, ENC 52.3, top codon CTG (RSCU 1.85).

---

seq module

jsrc seq extract -fa test/seq/test.fa -gff test/seq/test.gff -ids test/seq/ids.txt -o test/seq/extracted.fa -feature gene -match ID

Extract sequences by gene ID from FASTA+GFF, rename via CSV map, run QC stats, k-mer counting, and sliding-window analysis.

QC: 2 sequences, 268 bp total, GC 56.7%, N50 160.

k-mer (k=3): top ATC (40), TCG (40), CGA (39).

---

analyze module

jsrc analyze msa_consensus -fa test/analyze/aln.fa --json
jsrc analyze snpindel -fa test/analyze/aln.fa
jsrc analyze motif -fa test/analyze/aln.fa -o test/analyze/motif_out -minw 3 -maxw 5 -nmotifs 3
jsrc analyze phylo -fa test/analyze/aln.fa -o test/analyze/tree.nwk

• Consensus: ATGCTAGCTAGCTAGCTAGC, mean conservation 0.983
• SNP: seq1 vs seq3 has 1 SNP (alignment score 19/20)
• Motif (top): GCT (12), CTA (12), TAG (12)
• Phylogeny: (seq1:0.00000,seq2:0.00000,seq3:0.05000)Inner1:0.00000;

---

job module

Submit, monitor, and inspect background jobs:

Note: RSS/process-state metrics are most complete on Linux (/proc). On macOS/other Unix, job still works with ps fallback but some metrics may be limited.

jsrc job submit "echo 'job module test' && sleep 1 && echo done" -N test-job

job_id	1
pid	90288
log	/home/user/.local/share/jsrc/job-logs/1.log
status	running

jsrc job ls --limit 5

PID    S MEM TIME                   COMMAND
------ - --- ---------------------- -----------------------------------------------
90288  E 0.0 2026-04-26 11:47 / 4s  echo 'job module test' && sleep 1 && echo done

jsrc job logs 1

job module test
done