Skip to main content
Join the official 2019 Python Developers SurveyStart the survey!

Simple tools for working with DNA

Project description

When doing biology, sometimes you just need to quickly know how long a DNA sequence is, or what its reverse complement is. There are lots of tools out there that can tell you these things, but they often do a lot more than that too and can be overkill for really quick questions. In contrast, this package provides an easy-to-use command-line app that’s just designed to give simple answers to simple questions.

https://img.shields.io/pypi/v/kbkdna.svg https://img.shields.io/pypi/pyversions/kbkdna.svg https://img.shields.io/travis/kalekundert/kbkdna.svg https://readthedocs.org/projects/kbkdna/badge/?version=latest

Installation

You can install kbkdna from PyPI using pip:

$ pip install kbkdna

Usage

The command-line application that gets installed is called dna. You can use the --help flag to get information on the kinds of things it can calculate:

$ dna --help

You can use the len command to get the length of a DNA sequence:

$ dna len CATCTAATTCAACAAGAATT
20

You can use the rc command to get the reverse complement of a DNA sequence:

$ dna rc CATCTAATTCAACAAGAATT
AATTCTTGTTGAATTAGATG

You can use the gc command to calculate the GC content of a DNA sequence:

$ dna gc CATCTAATTCAACAAGAATT
25.0%

Project details


Release history Release notifications

This version

0.0.0

Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Files for kbkdna, version 0.0.0
Filename, size File type Python version Upload date Hashes
Filename, size kbkdna-0.0.0.tar.gz (1.9 kB) File type Source Python version None Upload date Hashes View hashes

Supported by

Elastic Elastic Search Pingdom Pingdom Monitoring Google Google BigQuery Sentry Sentry Error logging AWS AWS Cloud computing DataDog DataDog Monitoring Fastly Fastly CDN SignalFx SignalFx Supporter DigiCert DigiCert EV certificate StatusPage StatusPage Status page