python-linearfold
Unofficial CPython binding to LinearFold
Installation
Use pip to install the module.
pip install linearfold-unofficial
You may build from the source code for unsupported Python versions or platforms.
git clone --recursive https://github.com/ChangLabSNU/python-linearfold
cd python-linearfold
pip install .
Usage
The module currently only has one function called fold(seq), and
it doesn't have any customizable options other than the defaults.
The seq parameter should be an RNA sequence in uppercase letters,
and any T should be converted to U before passing it to the function.
>>> import linearfold
>>> seq = 'UGUCGGGUAGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCAUGGCAACACCAGUCGAUGGGCUGUCUGACA'
>>> linearfold.fold(seq)
('((((((((((((((((.(((((.(((((.(((.(((...))))))))))).)))))))))))))))))))))', -34.6)
The function returns a tuple with two elements. The first element is the predicted MFE structure, and the second element is the free energy of the structure in kcal/mol.
Author
Hyeshik Chang <hyeshik@snu.ac.kr>
License
This Python binding is licensed under the MIT-style license. However, the compiled binary includes code from the LinearFold package, which is licensed for non-commercial use.
1 maintainer
Metadata
1 maintainer
Release files for linearfold-unofficial 0.1
For a detailed explanation of source distributions (sdists) and built distributions (wheels), please see the package formats documentation.
Source distribution (sdist)
| File | Size | Uploaded | Provenance | Actions |
|---|---|---|---|---|
| linearfold-unofficial-0.1.tar.gz | 4.9 kB | Without provenance | Details for linearfold-unofficial-0.1.tar.gz |
Built distributions (wheels)
Total release size: 7.6 MB
Release files / linearfold-unofficial-0.1.tar.gz
| Download URL | linearfold-unofficial-0.1.tar.gz |
|---|---|
| Size | 4.9 kB |
| Tags | Source |
|
SHA-256 checksum How to use checksums |
7e3e7faf08f9a79fb068a1a7460f59d644d53778e9d1fa173cafb442bb568723
|
|
BLAKE2b-256 checksum How to use checksums |
7e960e96a3aba7b6b2a4585a57dcbc89010ffa7f635d3f6747f199bd73c825bd
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
No |
| Uploaded via |
twine/4.0.2 CPython/3.10.12
|
Release files / linearfold_unofficial-0.1-pp310-pypy310_pp73-manylinux_2_24_x86_64.manylinux_2_28_x86_64.whl
| Download URL | linearfold_unofficial-0.1-pp310-pypy310_pp73-manylinux_2_24_x86_64.manylinux_2_28_x86_64.whl |
|---|---|
| Size | 95.0 kB |
| Tags | Linux glibc 2.24+ x86-64 Linux glibc 2.28+ x86-64 PyPy 3.10 PyPy 3.10 7.3 |
|
SHA-256 checksum How to use checksums |
c58ced60c27438e7f0bd72d759b3e3b1282463cdb8b10235abd7e2466da9d357
|
|
BLAKE2b-256 checksum How to use checksums |
7edfca793c8a8ca2db35b03dd8ed00c5c9788645e76241f79cf613521d3d03e3
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
No |
| Uploaded via |
twine/4.0.2 CPython/3.10.12
|
Release files / linearfold_unofficial-0.1-pp39-pypy39_pp73-manylinux_2_24_x86_64.manylinux_2_28_x86_64.whl
| Download URL | linearfold_unofficial-0.1-pp39-pypy39_pp73-manylinux_2_24_x86_64.manylinux_2_28_x86_64.whl |
|---|---|
| Size | 95.0 kB |
| Tags | Linux glibc 2.24+ x86-64 Linux glibc 2.28+ x86-64 PyPy 3.9 PyPy 3.9 7.3 |
|
SHA-256 checksum How to use checksums |
55aa40f5dc36a9e0e6a16dd1b4a10b4ad10ad4b4df0a0dad4bf61435072591f8
|
|
BLAKE2b-256 checksum How to use checksums |
ec99bb2e55329085f3dacffafa09d58ca2cb7b4fb06a0ea6c1fb81ae7aef40a0
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
No |
| Uploaded via |
twine/4.0.2 CPython/3.10.12
|
Release files / linearfold_unofficial-0.1-pp38-pypy38_pp73-manylinux_2_24_x86_64.manylinux_2_28_x86_64.whl
| Download URL | linearfold_unofficial-0.1-pp38-pypy38_pp73-manylinux_2_24_x86_64.manylinux_2_28_x86_64.whl |
|---|---|
| Size | 95.0 kB |
| Tags | Linux glibc 2.24+ x86-64 Linux glibc 2.28+ x86-64 PyPy 3.8 PyPy 3.8 7.3 |
|
SHA-256 checksum How to use checksums |
f47d9cb6cb79a01918e23361aa3437b2c8ddf4ebeb68982388e29eb2a6f123ae
|
|
BLAKE2b-256 checksum How to use checksums |
39ffd3b60bd777cb0cbb8a3d9ddb13dda394c23257daa8f27fd94fee83c027e9
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
No |
| Uploaded via |
twine/4.0.2 CPython/3.10.12
|
Release files / linearfold_unofficial-0.1-pp37-pypy37_pp73-manylinux_2_24_x86_64.manylinux_2_28_x86_64.whl
| Download URL | linearfold_unofficial-0.1-pp37-pypy37_pp73-manylinux_2_24_x86_64.manylinux_2_28_x86_64.whl |
|---|---|
| Size | 96.2 kB |
| Tags | Linux glibc 2.24+ x86-64 Linux glibc 2.28+ x86-64 PyPy 3.7 PyPy 3.7 7.3 |
|
SHA-256 checksum How to use checksums |
54cec27d10bda9acaba11ef37fadadcd1aeff22b8e7420b659d531f06a344a11
|
|
BLAKE2b-256 checksum How to use checksums |
4cbed9370a710c317c2a07c39685ce4f088378e3e11c78e2a51376bbfd7cac07
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
No |
| Uploaded via |
twine/4.0.2 CPython/3.10.12
|
Release files / linearfold_unofficial-0.1-cp312-cp312-manylinux_2_24_x86_64.manylinux_2_28_x86_64.whl
| Download URL | linearfold_unofficial-0.1-cp312-cp312-manylinux_2_24_x86_64.manylinux_2_28_x86_64.whl |
|---|---|
| Size | 1.0 MB |
| Tags | CPython 3.12 Linux glibc 2.24+ x86-64 Linux glibc 2.28+ x86-64 |
|
SHA-256 checksum How to use checksums |
f91ce324ab556c3cf1727664558311332b73be0ca53f486826df28457fdfe786
|
|
BLAKE2b-256 checksum How to use checksums |
395fae76df3876e3ff25bda8266c13d8c71c7406d13146e016467bb58d117f23
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
No |
| Uploaded via |
twine/4.0.2 CPython/3.10.12
|
Release files / linearfold_unofficial-0.1-cp311-cp311-manylinux_2_24_x86_64.manylinux_2_28_x86_64.whl
| Download URL | linearfold_unofficial-0.1-cp311-cp311-manylinux_2_24_x86_64.manylinux_2_28_x86_64.whl |
|---|---|
| Size | 1.0 MB |
| Tags | CPython 3.11 Linux glibc 2.24+ x86-64 Linux glibc 2.28+ x86-64 |
|
SHA-256 checksum How to use checksums |
31a6c9e0ab08e7db1fa1e7ba3a932372374bfdeae90e5c7f48698561c185c8d1
|
|
BLAKE2b-256 checksum How to use checksums |
92a8cb615b91ee332fc3979fc0935663445447585d543c29b23289e08542077d
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
No |
| Uploaded via |
twine/4.0.2 CPython/3.10.12
|
Release files / linearfold_unofficial-0.1-cp310-cp310-manylinux_2_24_x86_64.manylinux_2_28_x86_64.whl
| Download URL | linearfold_unofficial-0.1-cp310-cp310-manylinux_2_24_x86_64.manylinux_2_28_x86_64.whl |
|---|---|
| Size | 1.0 MB |
| Tags | CPython 3.10 Linux glibc 2.24+ x86-64 Linux glibc 2.28+ x86-64 |
|
SHA-256 checksum How to use checksums |
77cd58bdfc1d114f115fd3a4020f7079d2495ba1fba8cd0de4250a070bd9ecbb
|
|
BLAKE2b-256 checksum How to use checksums |
7080064d01b91659a277d49cfdf046edc9735aaeec75a5545f2c136c0effef75
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
No |
| Uploaded via |
twine/4.0.2 CPython/3.10.12
|
Release files / linearfold_unofficial-0.1-cp39-cp39-manylinux_2_24_x86_64.manylinux_2_28_x86_64.whl
| Download URL | linearfold_unofficial-0.1-cp39-cp39-manylinux_2_24_x86_64.manylinux_2_28_x86_64.whl |
|---|---|
| Size | 1.0 MB |
| Tags | CPython 3.9 Linux glibc 2.24+ x86-64 Linux glibc 2.28+ x86-64 |
|
SHA-256 checksum How to use checksums |
2990ce774439b9782616bfd2d58c888fef0701bb9b4edd6504374173ca953331
|
|
BLAKE2b-256 checksum How to use checksums |
d1838fd6e42db61fcc40f7dbc989d8b53ea41f9ec67943f01d46282804f14741
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
No |
| Uploaded via |
twine/4.0.2 CPython/3.10.12
|
Release files / linearfold_unofficial-0.1-cp38-cp38-manylinux_2_24_x86_64.manylinux_2_28_x86_64.whl
| Download URL | linearfold_unofficial-0.1-cp38-cp38-manylinux_2_24_x86_64.manylinux_2_28_x86_64.whl |
|---|---|
| Size | 1.0 MB |
| Tags | CPython 3.8 Linux glibc 2.24+ x86-64 Linux glibc 2.28+ x86-64 |
|
SHA-256 checksum How to use checksums |
8d93f08ae0c3f6a89a9e9fac017031b35f80e010094479cf952c2d6eb3a268b6
|
|
BLAKE2b-256 checksum How to use checksums |
80edef6ed34f9836b64abbfb1837138910bc3115a0a1946c7ad65e8fbb27b972
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
No |
| Uploaded via |
twine/4.0.2 CPython/3.10.12
|
Release files / linearfold_unofficial-0.1-cp37-cp37m-manylinux_2_24_x86_64.manylinux_2_28_x86_64.whl
| Download URL | linearfold_unofficial-0.1-cp37-cp37m-manylinux_2_24_x86_64.manylinux_2_28_x86_64.whl |
|---|---|
| Size | 1.0 MB |
| Tags | CPython 3.7 CPython 3.7 pymalloc Linux glibc 2.24+ x86-64 Linux glibc 2.28+ x86-64 |
|
SHA-256 checksum How to use checksums |
b3b38072fa8bd840c64bdd59f80ebf749d2e0e4c30b57a8cc01669710411afc1
|
|
BLAKE2b-256 checksum How to use checksums |
dcd27b0689eea0bb333070a4f7b0c2efba9ef806067c691d082717d370418dad
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
No |
| Uploaded via |
twine/4.0.2 CPython/3.10.12
|
Release files / linearfold_unofficial-0.1-cp36-cp36m-manylinux_2_24_x86_64.manylinux_2_28_x86_64.whl
| Download URL | linearfold_unofficial-0.1-cp36-cp36m-manylinux_2_24_x86_64.manylinux_2_28_x86_64.whl |
|---|---|
| Size | 1.0 MB |
| Tags | CPython 3.6 CPython 3.6 pymalloc Linux glibc 2.24+ x86-64 Linux glibc 2.28+ x86-64 |
|
SHA-256 checksum How to use checksums |
ee631fa1f288eba54f659572f70d0c5bd1b491c76d069fcf70cafbed6737508c
|
|
BLAKE2b-256 checksum How to use checksums |
ca6f1b2d3328e7090e94421f0c2437fd0733cec7923d8fb1fb6a3bfdbeca6c40
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
No |
| Uploaded via |
twine/4.0.2 CPython/3.10.12
|
Security for linearfold-unofficial 0.1
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
No provenance found
None of the files in this release were uploaded with provenance metadata.
A note on package security
PyPI is a repository for distributing packages, not a service for auditing them. While third-party security researchers and our staff do their best to detect and remove malicious packages, PyPI cannot guarantee the quality, security or suitability of any given package.
To learn more about protecting yourself from malicious actors, visit our package security documentation.
