Skip to main content

Python client for Malva Index

Project description

Malva Client

PyPI Documentation GitHub

Python client for the Malva genomic search platform. Search genes, sequences, and natural language queries across >7,000 single-cell and spatial transcriptomics samples.

For full documentation, visit malva-client.readthedocs.io.

Installation

pip install malva-client

For single-cell analysis workflows:

pip install malva-client scanpy

Authentication

Generate an API token at malva.bio (login with ORCID, then go to Profile > Generate API Token), then configure the client:

malva_client config --server https://malva.mdc-berlin.de --token YOUR_API_TOKEN

Quick Start (CLI)

malva_client search "CD3D" --output results.csv
malva_client search "ATCGATCGATCGATCGATCGATCG" --format json
malva_client search "CD4 T cells in brain tissue"

Quick Start (Python)

from malva_client import MalvaClient

client = MalvaClient("https://malva.mdc-berlin.de", "YOUR_API_TOKEN")

# Search for genes, sequences, or natural language queries
results = client.search("CD3D")
print(results)

# Search for sequences
results = client.search("ATCGATCGATCGCCACATGGACTTGAC")

# Natural language queries
results = client.search("cells expressing markers of neurodegeneration")

Working with Results

# Enrich results with metadata
results.enrich_with_metadata()
fig = results.plot_expression_summary("cell_type")

# Filter and aggregate
filtered = results.filter_by(disease='normal', organ='brain')

See the tutorials for coverage analysis, dataset discovery, cell-level searches, and more.

Indexing Your Own Data

For local indexing and quantification, see Malva Tools (malva CLI).

Citation

If you use Malva in your research, please cite:

[TBA]

License

The Clear BSD License - Copyright (c) 2025-2026 Malva

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

malva_client-0.2.0.tar.gz (42.6 kB view details)

Uploaded Source

Built Distribution

If you're not sure about the file name format, learn more about wheel file names.

malva_client-0.2.0-py3-none-any.whl (43.1 kB view details)

Uploaded Python 3

File details

Details for the file malva_client-0.2.0.tar.gz.

File metadata

  • Download URL: malva_client-0.2.0.tar.gz
  • Upload date:
  • Size: 42.6 kB
  • Tags: Source
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/6.2.0 CPython/3.11.13

File hashes

Hashes for malva_client-0.2.0.tar.gz
Algorithm Hash digest
SHA256 b09ed4a7c3e14149658ec1ae85ed262f364c359c6f49fd8ebf48f2f834b7c0c3
MD5 a96c4cee5bd004e3ab1bdde8c8146aba
BLAKE2b-256 c2b6c5bf0867369bf9700c05e6ddf19f1181a9727696fbf44a0032b358f9299b

See more details on using hashes here.

File details

Details for the file malva_client-0.2.0-py3-none-any.whl.

File metadata

  • Download URL: malva_client-0.2.0-py3-none-any.whl
  • Upload date:
  • Size: 43.1 kB
  • Tags: Python 3
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/6.2.0 CPython/3.11.13

File hashes

Hashes for malva_client-0.2.0-py3-none-any.whl
Algorithm Hash digest
SHA256 2ed29c92324549ff097aa973183e08a3120552f310de3e6d8107693cd4738136
MD5 2e9143875e627316d93696aaac6d22ac
BLAKE2b-256 696c71d19ab01e38f63a6c2b0facb6799869ae5916e0ccdc2bdb1e73b69d71e6

See more details on using hashes here.

Supported by

AWS Cloud computing and Security Sponsor Datadog Monitoring Depot Continuous Integration Fastly CDN Google Download Analytics Pingdom Monitoring Sentry Error logging StatusPage Status page