A collection of datasets and predictors for benchmarking miRNA target site prediction algorithms
Project description
miRNA target site prediction Benchmarks
Installation
miRBench package can be easily installed using pip:
pip install miRBench
Default installation allows access to the datasets. To use predictors and encoders, you need to install additional dependencies.
Dependencies for predictors and encoders
To use miRBench with predictors and encoders, install the following dependencies:
- numpy
- biopython
- viennarna
- torch
- tensorflow
- typing-extensions
To install the miRBench package with all dependencies into a virtual environment, you can use the following commands:
python3.8 -m venv mirbench_venv
source mirbench_venv/bin/activate
pip install miRBench
pip install numpy==1.24.3 biopython==1.83 viennarna==2.7.0 torch==1.9.0 tensorflow==2.13.1 typing-extensions==4.5.0
Note: This instalation is for running predictors on the CPU. If you want to use GPU, you need to install version of torch and tensorflow with GPU support.
Examples
Get all available datasets
The dataset module is responsible for access to the benchmark datasets described in the miRBench paper.
from miRBench.dataset import list_datasets
list_datasets()
['AGO2_CLASH_Hejret2023',
'AGO2_eCLIP_Klimentova2022',
'AGO2_eCLIP_Manakov2022']
Not all datasets are available with all splits. To get available splits, use the full option.
list_datasets(full=True)
{'AGO2_CLASH_Hejret2023': {'splits': ['train', 'test']},
'AGO2_eCLIP_Klimentova2022': {'splits': ['test']},
'AGO2_eCLIP_Manakov2022': {'splits': ['train', 'test', 'leftout']}}
Get dataset
from miRBench.dataset import get_dataset_df
dataset_name = "AGO2_CLASH_Hejret2023"
df = get_dataset_df(dataset_name, split="test")
df.head()
| gene | noncodingRNA | noncodingRNA_name | noncodingRNA_fam | feature | label | chr | start | end | strand | gene_cluster_ID | |
|---|---|---|---|---|---|---|---|---|---|---|---|
| 0 | AAAGCTGTGGAACGCTACCTCTTCCTTTGAG... | TGAGGTAGTAGGTTGTATAGTT | hsa-let-7a-5p | let-7 | exon | 1 | 1 | 212100882 | 212100931 | + | 2391 |
| 1 | TCACCTCAGACTCTGTCCAACCTCTGCCTCA... | TGAGGTAGTAGGTTGTGTGGTT | hsa-let-7a-5p | let-7 | exon | 1 | 1 | 35913919 | 35913968 | + | 3972 |
| 2 | TTATATGTGCCCAGTGTGGCAAAACCTTCAA... | TGAGGTAGTAGGTTGTATAGTT | hsa-let-7a-5p | let-7 | exon | 1 | 1 | 42851209 | 42851258 | + | 222 |
| 3 | TGAGGCCCTCTTCCTGCTCGTCACCTCCGTC... | TGAGGTAGTAGGTTGTATAGTT | hsa-let-7a-5p | let-7 | exon | 1 | 1 | 43961210 | 43961259 | + | 1253 |
| 4 | ATAAAATTTACGTTTTTAACTATACAATCTAC... | TGAGGTAGTAGGTTGTATAGTT | hsa-let-7a-5p | let-7 | intron | 1 | 1 | 244661046 | 244661095 | + | 1252 |
If you want to get just a path to the dataset, use the get_dataset_path function:
from miRBench.dataset import get_dataset_path
dataset_path = get_dataset_path(dataset_name, split="test")
dataset_path
/home/user/.miRBench/datasets/14501607/AGO2_CLASH_Hejret2023/test/dataset.tsv
Get all available tools
from miRBench.predictor import list_predictors
list_predictors()
['CnnMirTarget_Zheng2020',
'RNACofold',
'miRNA_CNN_Hejret2023',
'miRBind_Klimentova2022',
'TargetNet_Min2021',
'Seed8mer',
'Seed7mer',
'Seed6mer',
'Seed6merBulgeOrMismatch',
'TargetScanCnn_McGeary2019',
'InteractionAwareModel_Yang2024',
'miRBenchCNN_Manakov',
'miRBenchCNN_HejretCorrected']
Encode dataset
The encoder module is responsible for encoding data into the format expected by a predictor module. The main function of the module is get_encoder(predictor_name) which returns an instance of an encoder object implemented for a specified predictor. The encoder expects data as a Pandas DataFrame with columns named ‘noncodingRNA’ and ‘gene’. Specifying custom column names is possible when calling the encoder. The returned data format differs for every encoder and is specific to the predictor.
from miRBench.encoder import get_encoder
tool = 'miRBind_Klimentova2022'
encoder = get_encoder(tool)
input = encoder(df)
Get predictions
The predictor module is responsible for predicting miRNA-binding site interaction. The main function of the module is get_predictor(predictor_name) which returns an instance of a specified predictor object. The predictor object expects data encoded by a corresponding encoder and returns an array of predictions.
from miRBench.predictor import get_predictor
predictor = get_predictor(tool)
predictions = predictor(input)
predictions[:10]
array([0.6899161 , 0.15220629, 0.07301956, 0.43757868, 0.34360734,
0.20519172, 0.0955029 , 0.79298246, 0.14150576, 0.05329492],
dtype=float32)
Citing miRBench
If you use miRBench in your research, please cite the following article:
Sammut, Stephanie, et al. miRBench: novel benchmark datasets for microRNA binding site prediction that mitigate against prevalent microRNA frequency class bias. Bioinformatics 41.Supplement_1 (2025): i542-i551.
Project details
Release history Release notifications | RSS feed
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
File details
Details for the file mirbench-1.0.2.tar.gz.
File metadata
- Download URL: mirbench-1.0.2.tar.gz
- Upload date:
- Size: 17.4 kB
- Tags: Source
- Uploaded using Trusted Publishing? No
- Uploaded via: twine/6.2.0 CPython/3.12.2
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
a5ee822c487aa5737e16116b805ba6c42b73bbb04219a44e7b9c0feccf93ba57
|
|
| MD5 |
5726a54356e44875d56fccd8a67b3559
|
|
| BLAKE2b-256 |
b2d296f9db2af7dd94bd5fbfcb990cd08d90004d8573b062016105ab4eec8296
|