Skip to main content

miRmap - Comprehensive prediction of microRNA target repression strength

The miRmap library is a Python library predicting the repression strength of microRNA (miRNA) targets. The model combines:

  • thermodynamic features: ΔG duplex, ΔG binding, ΔG seed duplex, ΔG seed binding, ΔG open and ΔG total,
  • evolutionary features: BLS and PhyloP,
  • probabilistic features: P.over binomial and P.over exact, and
  • sequence-based features: AU content, UTR position and 3' pairing.

NOTE This is a reimplementation by the same author of the miRmap library published in 2011 with most of the core algorithm unchanged. Please refer to the miRmap1 repository for the old library.

Online

miRmap is available online.

Download

See refs page.

Citation

If you use miRmap for your research, please cite:

Charles E. Vejnar and Evgeny M. Zdobnov
miRmap: Comprehensive prediction of microRNA target repression strength
Nucleic Acids Research 2012 Dec 1;40(22):11673-83. doi: 10.1093/nar/gks901

Installation

External dependencies

  1. The Spatt library is necessary for the P.over exact feature.

    Download the latest Spatt tarball (Version 2.1 was successfully tested), then do:

    cd spatt-<version>
    mkdir build
    cd build
    cmake -DWITH_SHARED_LIB=ON ..
    make
    

    To create the library at libspatt2/libspatt2.so.

  2. PHAST is necessary for the evolutionary features. Compilation instructions of PHAST are available in this PKGBUILD.

Using pip

After installing external dependencies, install miRmap:

pip3 install mirmap

Python dependencies ViennaRNA and dendropy will be installed from PyPI.

Example

import mirmap.target

utr_seq = "ATAGACTGTACATTATGAAGAATACCCAGGAAGACTTTGTGACTGTCACTTGCTGCTTTTTCTGCGCTTCAGTAACAAGT"
mirna_seq = "UAGCAGCACGUAAAUAUUGGCG".replace("U", "T")

targets = mirmap.target.find_targets_with_seed(utr_seq, mirna_seq)
print(targets[0].report())

This will return:

          36                   57
          |                    |
CAGGAAGACTTTGTGACTGTCACTTGCTGCTTTTTCTGCGCT
                        |||||||
          GCGGTTATAAATGCACGACGAT

Then we can calculate the scores of the miRNA target:

import mirmap.if_lib_spatt
import mirmap.scores

if_spatt = mirmap.if_lib_spatt.Spatt("bin/linux_x86_64/libspatt2.so")

scores = mirmap.scores.calc_scores(
    targets[0],
    if_spatt=if_spatt,
)
print(mirmap.scores.report_scores(scores))

This will return:

 ΔG duplex (kcal/mol)     -13.8
 ΔG binding (kcal/mol)    -11.95
 ΔG open (kcal/mol)       14.03
 ΔG total (kcal/mol)      0.2345
 AU content               0.6574
 UTR position             22.0
 3' pairing               1.0
 TargetScan score         23.66
 Probability (Exact)      0.03813
 Probability (Binomial)   0.006405
 Conservation (BLS)       0.0
 Conservation (PhyloP)    1.0
 miRmap score             -0.3122

License

The miRmap library is distributed under the GNU GPL v3 (see /LICENSE).

Copyright © 2011-2024 Charles E. Vejnar

Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

miRmap-2.0.0.tar.gz (1.2 MB view details)

Uploaded Source

Built Distribution

If you're not sure about the file name format, learn more about wheel file names.

miRmap-2.0.0-py3-none-any.whl (35.5 kB view details)

Uploaded Python 3

File details

Details for the file miRmap-2.0.0.tar.gz.

File metadata

  • Download URL: miRmap-2.0.0.tar.gz
  • Upload date:
  • Size: 1.2 MB
  • Tags: Source
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/4.0.2 CPython/3.11.7

File hashes

Hashes for miRmap-2.0.0.tar.gz
Algorithm Hash digest
SHA256 d8cdcaa65d13456a342c297f55510d1d6f58a4ff3f94e5aee1959f3c01821b9c
MD5 fd13a7b3cf3fb27c6efe823cb9c47a3e
BLAKE2b-256 986d5f2cf1899638f660f7171ea4aea4c78b705c63615384963721f7f2bd9c9c

See more details on using hashes here.

File details

Details for the file miRmap-2.0.0-py3-none-any.whl.

File metadata

  • Download URL: miRmap-2.0.0-py3-none-any.whl
  • Upload date:
  • Size: 35.5 kB
  • Tags: Python 3
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/4.0.2 CPython/3.11.7

File hashes

Hashes for miRmap-2.0.0-py3-none-any.whl
Algorithm Hash digest
SHA256 5d3bd491f6e66586051d3cf58970bce27cfd723c5c1aef3f028bd9e822924bf6
MD5 4ea30e2d03e51f85959b642aff148c8c
BLAKE2b-256 6ad7d7397a3d57d929bfbe42223013c60242a4d714d2e0f61f769aded2d1d949

See more details on using hashes here.

Release history Release notifications | RSS feed

This release

2.0.0 This release

2 files

Anthropic, PBC Visionary sponsor Bloomberg Visionary sponsor Hudson River Trading Visionary sponsor Meta Visionary sponsor NVIDIA Visionary sponsor Microsoft Sustainability sponsor Depot Continuous Integration AWS Cloud computing and Security Sponsor Datadog Monitoring Fastly CDN Google Download Analytics Sentry Error logging StatusPage Status page