miRmap - Comprehensive prediction of microRNA target repression strength
The miRmap library is a Python library predicting the repression strength of microRNA (miRNA) targets. The model combines:
- thermodynamic features: ΔG duplex, ΔG binding, ΔG seed duplex, ΔG seed binding, ΔG open and ΔG total,
- evolutionary features: BLS and PhyloP,
- probabilistic features: P.over binomial and P.over exact, and
- sequence-based features: AU content, UTR position and 3' pairing.
NOTE This is a reimplementation by the same author of the miRmap library published in 2011 with most of the core algorithm unchanged. Please refer to the miRmap1 repository for the old library.
Online
miRmap is available online.
Download
See refs page.
Citation
If you use miRmap for your research, please cite:
Charles E. Vejnar and Evgeny M. Zdobnov
miRmap: Comprehensive prediction of microRNA target repression strength
Nucleic Acids Research 2012 Dec 1;40(22):11673-83. doi: 10.1093/nar/gks901
Installation
External dependencies
-
The Spatt library is necessary for the P.over exact feature.
Download the latest Spatt tarball (Version 2.1 was successfully tested), then do:
cd spatt-<version> mkdir build cd build cmake -DWITH_SHARED_LIB=ON .. make
To create the library at
libspatt2/libspatt2.so. -
PHAST is necessary for the evolutionary features. Compilation instructions of PHAST are available in this PKGBUILD.
Using pip
After installing external dependencies, install miRmap:
pip3 install mirmap
Python dependencies ViennaRNA and dendropy will be installed from PyPI.
Example
import mirmap.target
utr_seq = "ATAGACTGTACATTATGAAGAATACCCAGGAAGACTTTGTGACTGTCACTTGCTGCTTTTTCTGCGCTTCAGTAACAAGT"
mirna_seq = "UAGCAGCACGUAAAUAUUGGCG".replace("U", "T")
targets = mirmap.target.find_targets_with_seed(utr_seq, mirna_seq)
print(targets[0].report())
This will return:
36 57
| |
CAGGAAGACTTTGTGACTGTCACTTGCTGCTTTTTCTGCGCT
|||||||
GCGGTTATAAATGCACGACGAT
Then we can calculate the scores of the miRNA target:
import mirmap.if_lib_spatt
import mirmap.scores
if_spatt = mirmap.if_lib_spatt.Spatt("bin/linux_x86_64/libspatt2.so")
scores = mirmap.scores.calc_scores(
targets[0],
if_spatt=if_spatt,
)
print(mirmap.scores.report_scores(scores))
This will return:
ΔG duplex (kcal/mol) -13.8
ΔG binding (kcal/mol) -11.95
ΔG open (kcal/mol) 14.03
ΔG total (kcal/mol) 0.2345
AU content 0.6574
UTR position 22.0
3' pairing 1.0
TargetScan score 23.66
Probability (Exact) 0.03813
Probability (Binomial) 0.006405
Conservation (BLS) 0.0
Conservation (PhyloP) 1.0
miRmap score -0.3122
License
The miRmap library is distributed under the GNU GPL v3 (see /LICENSE).
Copyright © 2011-2024 Charles E. Vejnar
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
Built Distribution
Filter files by name, interpreter, ABI, and platform.
If you're not sure about the file name format, learn more about wheel file names.
Copy a direct link to the current filters
File details
Details for the file miRmap-2.0.0.tar.gz.
File metadata
- Download URL: miRmap-2.0.0.tar.gz
- Upload date:
- Size: 1.2 MB
- Tags: Source
- Uploaded using Trusted Publishing? No
- Uploaded via:
twine/4.0.2 CPython/3.11.7
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
d8cdcaa65d13456a342c297f55510d1d6f58a4ff3f94e5aee1959f3c01821b9c
|
|
| MD5 |
fd13a7b3cf3fb27c6efe823cb9c47a3e
|
|
| BLAKE2b-256 |
986d5f2cf1899638f660f7171ea4aea4c78b705c63615384963721f7f2bd9c9c
|
File details
Details for the file miRmap-2.0.0-py3-none-any.whl.
File metadata
- Download URL: miRmap-2.0.0-py3-none-any.whl
- Upload date:
- Size: 35.5 kB
- Tags: Python 3
- Uploaded using Trusted Publishing? No
- Uploaded via:
twine/4.0.2 CPython/3.11.7
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
5d3bd491f6e66586051d3cf58970bce27cfd723c5c1aef3f028bd9e822924bf6
|
|
| MD5 |
4ea30e2d03e51f85959b642aff148c8c
|
|
| BLAKE2b-256 |
6ad7d7397a3d57d929bfbe42223013c60242a4d714d2e0f61f769aded2d1d949
|