MOLecular Beacons powered by ExonucleaseIII RecYcling.
Molbery is a python based tool which identifies 29mer probes with 7 bases in stem, 8 in loop and 7 overhang bases from a fasta sequence. This is based on the method developed by Zuo, Xiaolei, et al. [Ref1] which descibes an Exo III aided target recycling method for nucleic acid signature amplification. It uses the formula suggested by Howley, Peter M., et al. [Ref2] for calculation of melting temperature of the probes. Other than general criteria like GC content & Tm, there are special considerations in the property of the probe sequence which are reported to be optimal. More information will be available after publication of the tool in a scientific journal.
Features
The latest release includes:
Support for Fasta & multi-Fasta format
Manual specification of GC content, Tm range & Salt Conc.
reStructuredText Output
BLAST connect with parallel execution
Compatibility
Molbery is a cross platform tool which runs on Windows, Linux and OS X with the latest & major releases of python 2 & 3.
License
Molbery is an open source tool available under the OSI approved MIT license.
Copyright (c) 2016 Bhagya C T
Copyright (c) 2016 Manu S
Please read the license content here.
Installation
All the Python packages required for Molbery will be installed with pip.
Run cmd with Administrator permissions in Windows.
> pip install molberyRun command with sudo permissions in Linux and OS X.
$ sudo pip install molberyYou can manually download the Molbery repository or simply clone it.
$ git clone https://github.com/bhagya-ct/molbery
Usage
After succesful installation refer command help for all available options.
$ molbery --helpFor a single FASTA input run
$ molbery <path_to_fasta> --blast --out <output> -g <GC_min> -c <GC_max> -t <Tm_min> -m <Tm_max> -s <salt_conc_in_molar_units>For a multi-FASTA input run (Output cannot be specified for multiple seq. Default is sequence ID present in multi-FASTA)
$ molbery <path_to_fasta> --blast --multi -g <GC_min> -c <GC_max> -t <Tm_min> -m <Tm_max> -s <salt_conc_in_molar_units>
Sample Output
Sequence ID - <gid_of_sequence>
Probe |
Molberys (29mer Probes) |
GC (%) |
Tm (C) |
Stem Tm (C) |
Loop Tm (C) |
|---|---|---|---|---|---|
1 |
ACCGTAGAGCTACGACTACGGTACATTAC |
48.28 |
69.9 |
22 |
24 |
2 |
AGTCGTATGCATACGTACGACTAAGCTAC |
44.83 |
68.9 |
20 |
24 |
3 |
ACTTTTCGTGCTGAAGAAAAGTGAAAGCG |
41.38 |
66.9 |
18 |
24 |
4 |
AGCTTAGACGTACGACTAAGCTACGACTA |
44.83 |
68.9 |
20 |
24 |
5 |
AGATTCGAAGCGAACCGAATCTGCATACG |
48.28 |
69.9 |
20 |
24 |
Note: Blast Outputs are written to <Output>_blast_results/ folder with individual text file for every probe.
Source code
The source codes of Molbery are available
via git: https://github.com/bhagya-ct/molbery
via Pypi: https://pypi.python.org/pypi/molbery
Credits
Thanks to the Pythonistas for some wonderful plugin modules and libraries which saves a lot of Caffeine and Code!
FAQs
Q1) pip command not found?
Ans. You probably don’t have the latest release of Python. Update Python or install pip.
Q2) Installation was successful but could not find molbery command?
Ans. You would not have given Admin or sudo permissions while installing. Run $ pip uninstall molbery and reinstall with Admin or sudo permissions.
Bugs
If you find a bug in molbery (pypi), please try to reproduce it with latest python 2.7 and 3.5.
If the problem persists, please file a bug in the github issue tracking system in the repository page. For questions, troubleshooting and requests, please feel free to contact us at bhagyathimmappa@gmail.com or smanu@ibab.ac.in
References
Zuo, X., Xia, F., Xiao, Y., & Plaxco, K. W. (2010). Sensitive and selective amplified fluorescence DNA detection based on exonuclease III-aided target recycling. Journal of the American Chemical Society, 132(6), 1816-1818.
Howley, P. M., Israel, M. A., Law, M. F., & Martin, M. A. (1979). A rapid method for detecting and mapping homology between heterologous DNAs. Evaluation of polyomavirus genomes. Journal of Biological Chemistry, 254(11), 4876-4883.
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
Built Distribution
Filter files by name, interpreter, ABI, and platform.
If you're not sure about the file name format, learn more about wheel file names.
Copy a direct link to the current filters
File details
Details for the file molbery-1.0.6.tar.gz.
File metadata
- Download URL: molbery-1.0.6.tar.gz
- Upload date:
- Size: 7.8 kB
- Tags: Source
- Uploaded using Trusted Publishing? No
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
c5a4e3998d781f780c2d132f1d3ed5fd9632de5ca6405f02840b1edc8285c22d
|
|
| MD5 |
f046bec46e2a41d1b94bdce6b38b6673
|
|
| BLAKE2b-256 |
e468aaeb84d04107fd1790dfc1d4ee02b591401b4decc7aff82ca39c5e786d6e
|
File details
Details for the file molbery-1.0.6-py2.py3-none-any.whl.
File metadata
- Download URL: molbery-1.0.6-py2.py3-none-any.whl
- Upload date:
- Size: 10.9 kB
- Tags: Python 2, Python 3
- Uploaded using Trusted Publishing? No
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
6e31306d55705a546d1b4fc269e76a5f2a2ba9f8a1c668e7fa6fb2ad5da4ed50
|
|
| MD5 |
677da4010861d61cf3181548e0c80459
|
|
| BLAKE2b-256 |
7a1e8dfa71ee89536f64a358b923d7bcd3a1b47ba61dd033cd7d69b5312714db
|