MultiMolecule

[!TIP] Accelerate Molecular Biology Research with Machine Learning.

DOI

Codacy - Quality Codacy - Coverage CodeCov - Coverage

PyPI - Version PyPI - Python Version Downloads Statistics

License: AGPL v3

MultiMolecule is a one-stop ecosystem for molecular machine learning. It connects datasets, model implementations, reusable dataset and neural-network modules, the DanLing-based runner for training and evaluation, and task-oriented inference pipelines for RNA, DNA, and protein workflows.

Get Started

Install the latest stable release from PyPI:

pip install multimolecule

Run a registered pipeline through the Hugging Face transformers interface:

import multimolecule  # registers MultiMolecule models and pipelines
from transformers import pipeline

predictor = pipeline("rna-secondary-structure", model="multimolecule/ernierna-ss")
result = predictor("AUCAGCCUUCGUUCUGUAAACGG")

Load models directly when you need lower-level control:

import multimolecule

model = multimolecule.AutoModelForSequencePrediction.from_pretrained("multimolecule/basset")
tokenizer = multimolecule.AutoTokenizer.from_pretrained("multimolecule/basset")

Install the latest source version when you need unreleased changes:

pip install git+https://github.com/DLS5-Omics/MultiMolecule

Explore

Entry point Use it for
data Task-aware datasets, data loading, and multi-task sampling.
datasets Curated biomolecular datasets and task metadata.
io FASTA, DBN, BPSEQ, and bpRNA ST readers and writers.
models Model cards and API references for supported architectures.
tokenisers DNA, RNA, protein, and dot-bracket tokenisers.
pipelines Task-focused inference workflows for supported biological tasks.
runner Training, evaluation, and inference configuration.
modules Reusable neural-network building blocks.

Community

  • Discourse: release announcements, usage questions, model requests, RFCs, and community discussion.
  • GitHub Issues: reproducible bugs, API issues, and implementation-tracked feature requests.
  • Hugging Face: released checkpoints, datasets, and demo Spaces.

Citation

[!NOTE] The artifacts distributed in this repository are part of the MultiMolecule project. If MultiMolecule supports your research, please cite the MultiMolecule project as follows:

@software{chen_2024_12638419,
  author    = {Chen, Zhiyuan and Zhu, Sophia Y.},
  title     = {MultiMolecule},
  doi       = {10.5281/zenodo.12638419},
  publisher = {Zenodo},
  url       = {https://doi.org/10.5281/zenodo.12638419},
  year      = 2024,
  month     = may,
  day       = 4
}

License

We believe openness is the Foundation of Research.

MultiMolecule is licensed under the GNU Affero General Public License.

For additional terms and clarifications, please refer to our License FAQ.

Please join us in building an open research community.

SPDX-License-Identifier: AGPL-3.0-or-later

Project links

Data verified by PyPI on Jul 24, 2026
Data provided by the project maintainers, verified at the time the release was uploaded to PyPI.

Key dates

PyPI data
Data sourced directly from PyPI's database.
  • Released:
Latest release

1 maintainer

PyPI data
Data sourced directly from PyPI's database.
Avatar for zyc from gravatar.com zyc

Credits

PyPI data
Data sourced directly from PyPI's database.

Author/Maintainer: Zhiyuan Chen

GitHub Statistics

Data verified by PyPI on Jul 24, 2026
The GitHub source repository was provided by the project maintainers and verified by PyPI at the time of upload. Stars, forks, and open issues/PRs are derived from that repository and have not been independently verified.

License

GNU Affero General Public License v3 or later (AGPLv3+) (# GNU AFFERO GENERAL PUBLIC LICENSE)

Requires

Python >=3.10

Tags

deep-learning DNA machine-learning Protein RNA

Classifiers

Report project as malware

Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

multimolecule-0.2.1.tar.gz (2.3 MB view details)

Uploaded Source

Built Distribution

If you're not sure about the file name format, learn more about wheel file names.

multimolecule-0.2.1-py3-none-any.whl (2.3 MB view details)

Uploaded Python 3

File details

Details for the file multimolecule-0.2.1.tar.gz.

File metadata

  • Download URL: multimolecule-0.2.1.tar.gz
  • Upload date:
  • Size: 2.3 MB
  • Tags: Source
  • Uploaded using Trusted Publishing? Yes
  • Uploaded via: twine/6.1.0 CPython/3.13.14

File hashes

Hashes for multimolecule-0.2.1.tar.gz
Algorithm Hash digest
SHA256 52c39dd3a06cb8fe15e26af441fa191eb6975ad18375b980d425b9aac9919099
MD5 b78466651333ef9b0e8491a5b447bed6
BLAKE2b-256 6f37af448088a3e6d70c131c0eb336283f0f34b13493ceddf30d03fc14d8f483

See more details on using hashes here.

Provenance

The following attestation bundles were made for multimolecule-0.2.1.tar.gz:

Publisher: push.yaml on DLS5-Omics/multimolecule

Attestations: Values shown here reflect the state when the release was signed and may no longer be current.

File details

Details for the file multimolecule-0.2.1-py3-none-any.whl.

File metadata

  • Download URL: multimolecule-0.2.1-py3-none-any.whl
  • Upload date:
  • Size: 2.3 MB
  • Tags: Python 3
  • Uploaded using Trusted Publishing? Yes
  • Uploaded via: twine/6.1.0 CPython/3.13.14

File hashes

Hashes for multimolecule-0.2.1-py3-none-any.whl
Algorithm Hash digest
SHA256 c39d910797ba2fdf56086fdcbb7120865f95d652fb2b73f7dd34d057b60fdbab
MD5 f76a300e55f8ed1cc9d210c317c3c7f6
BLAKE2b-256 a685220925e8496fdcf0fc1fe3bc76cb4ec889e1bf11df4573153210f929aeab

See more details on using hashes here.

Provenance

The following attestation bundles were made for multimolecule-0.2.1-py3-none-any.whl:

Publisher: push.yaml on DLS5-Omics/multimolecule

Attestations: Values shown here reflect the state when the release was signed and may no longer be current.

Supported by

AWS Cloud computing and Security Sponsor Datadog Monitoring Depot Continuous Integration Fastly CDN Google Download Analytics Sentry Error logging StatusPage Status page