RNA secondary structure prediction using deep neural networks with thermodynamic integrations
Project description
MXfold2
RNA secondary structure prediction using deep learning with thermodynamic integrations
Installation
System requirements
- python (>=3.7)
- pytorch (>=1.4)
- C++17 compatible compiler (tested on Apple clang version 12.0.0 and GCC version 7.4.0) (optional)
- cmake (>=3.10) (optional)
Install from wheel
We provide the wheel python packages for several platforms at the release. You can download an appropriate package and install it as follows:
% pip3 install mxfold2-0.1.1-cp38-cp38-macosx_10_15_x86_64.whl
Install from sdist
You can build and install from the source distribution downloaded from the release as follows:
% pip3 install mxfold2-0.1.1.tar.gz
To build MXfold2 from the source distribution, you need a C++17 compatible compiler and cmake.
Prediction
You can predict RNA secondary structures of given FASTA-formatted RNA sequences like:
% mxfold2 predict test.fa
>DS4440
GGAUGGAUGUCUGAGCGGUUGAAAGAGUCGGUCUUGAAAACCGAAGUAUUGAUAGGAAUACCGGGGGUUCGAAUCCCUCUCCAUCCG
(((((((........(((((..((((.....))))...)))))...................(((((.......)))))))))))). (24.8)
By default, MXfold2 employs the parameters trained from TrainSetA and TrainSetB (see our paper).
We provide other pre-trained models used in our paper. You can download models-0.1.0.tar.gz and extract the pre-trained models from it as follows:
% tar -zxvf models-0.1.0.tar.gz
Then, you can predict RNA secondary structures of given FASTA-formatted RNA sequences like:
% mxfold2 predict @./models/TrainSetA.conf test.fa
>DS4440
GGAUGGAUGUCUGAGCGGUUGAAAGAGUCGGUCUUGAAAACCGAAGUAUUGAUAGGAAUACCGGGGGUUCGAAUCCCUCUCCAUCCG
(((((((.((....))...........(((((.......))))).(((((......))))).(((((.......)))))))))))). (24.3)
Here, ./models/TrainSetA.conf specifies a lot of parameters including hyper-parameters of DNN models.
Training
MXfold2 can train its parameters from BPSEQ-formatted RNA sequences. You can also download the datasets used in our paper at the release.
% mxfold2 train --model MixC --param model.pth --save-config model.conf data/TrainSetA.lst
You can specify a lot of model's hyper-parameters. See mxfold2 train --help. In this example, the model's hyper-parameters and the trained parameters are saved in model.conf and model.pth, respectively.
Web server
Comming soon.
References
- Sato, K., Akiyama, M., Sakakibara, Y.: RNA secondary structure prediction using deep learning with thermodynamic integrations, preprint.
Project details
Release history Release notifications | RSS feed
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
Built Distribution
Filter files by name, interpreter, ABI, and platform.
If you're not sure about the file name format, learn more about wheel file names.
Copy a direct link to the current filters
File details
Details for the file mxfold2-0.1.1.tar.gz.
File metadata
- Download URL: mxfold2-0.1.1.tar.gz
- Upload date:
- Size: 3.5 MB
- Tags: Source
- Uploaded using Trusted Publishing? No
- Uploaded via: twine/4.0.1 CPython/3.10.1
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
9f39c6ff4138212d1ad2639005f5c05ffb4df0f7e22f5e7ad49466a05aa047e5
|
|
| MD5 |
4a21620aa4668e6efbdaa6f10a17a87c
|
|
| BLAKE2b-256 |
7a6fb9bf5423e82c49c04747581e0ee616844bd23cdbc4a561e50cb16107da84
|
File details
Details for the file mxfold2-0.1.1-py3-none-any.whl.
File metadata
- Download URL: mxfold2-0.1.1-py3-none-any.whl
- Upload date:
- Size: 3.7 MB
- Tags: Python 3
- Uploaded using Trusted Publishing? No
- Uploaded via: twine/4.0.1 CPython/3.10.1
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
8343dce235b16e782485cd269f41a08a185339f60f07f1912aa4cf145194cfc7
|
|
| MD5 |
86902f5a75188e0809e706d4959c9e82
|
|
| BLAKE2b-256 |
44a7df1df576b2d706ceebb600d84703279d5b25d28ee5ec98861cf84c437207
|