1. NCBI-Parser
Search any term from all NCBI databases to obtain matched entries, and download all NCBI GenBank format files and sequences corresponding to accessory number in genbank directory, finally export all Species Latin names, Accessory Number, Sequence Length, Division, Collection Country, Collection Date, Collected Worker, Identified Worker, and Reference information, etc. of the search records as tabular files.
Developer: https://github.com/benben-miao
Github: https://github.com/benben-miao/NCBI-Parser
PyPI: https://pypi.org/project/ncbiparser/
2. Usage
# Install the package
pip install ncbiparser
# Run the command internally
ncbiparser --help
Usage: ncbi-parser.exe [OPTIONS]
Description: Search any term from all NCBI databases to obtain matched
entries, and download all NCBI GenBank format files and sequences
corresponding to accessory number in genbank directory, finally export all
Species Latin names, Accessory Number, Sequence Length, Division, Collection
Country, Collection Date, Collected Worker, Identified Worker, and Reference
information, etc. of the search records as tabular files.
1. Get options and parameters help:
ncbiparser --help
2. Example (simple information). Users only need to input the search term,
and the default search is in NCBI nucleotide database:
ncbiparser --term "Acanthopagrus 16S" --output results.xls
3. Example (complete information). Specify the NCBI database type, input the
search term, specify the number of records to download and extract, and
suggest setting a larger parameter max_record:
ncbiparser --db_type nucleotide --term "Acanthopagrus 16S" --max_record 500
--res_type gb --output results.xls
Options:
--db_type TEXT Please input NCBI database type, default: "nucleotide",
including: [pubmed, protein, nuccore, ipg, nucleotide,
structure, genome, annotinfo, assembly, bioproject,
biosample, blastdbinfo, books, cdd, clinvar, gap,
gapplus, grasp, dbvar, gene, gds, geoprofiles,
homologene, medgen, mesh, ncbisearch, nlmcatalog, omim,
orgtrack, pmc, popset, proteinclusters, pcassay, protfam,
pccompound, pcsubstance, seqannot, snp, sra, taxonomy,
biocollections, gtr] [required]
--term TEXT Please input search term content, default: "Acanthopagrus
16S" [required]
--max_record TEXT Please input max record number, default: "100", up to:
10000 [required]
--res_type TEXT Please input result type, default: "gb", including:
["gb", "fasta", "gbwithparts", "gbcoll"]
--output TEXT Please input output full name (path + name + extension).
default="results.xls"
--help Show this message and exit.
3. NCBI GenBank format
LOCUS LC649152 1081 bp DNA linear VRT 03-SEP-2021
DEFINITION Acanthopagrus bifasciatus Kuroshio Biological Research Foundation
KBF-I 361 mitochondrial genes for 12S rRNA, tRNA-Val, 16S rRNA,
partial and complete sequence.
ACCESSION LC649152
VERSION LC649152.1
KEYWORDS .
SOURCE mitochondrion Acanthopagrus bifasciatus (twobar seabream)
ORGANISM Acanthopagrus bifasciatus
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
Acanthomorphata; Eupercaria; Spariformes; Sparidae; Acanthopagrus.
REFERENCE 1
AUTHORS Sado,T., Fukuchi,T. and Miya,M.
TITLE Reference data for MiFish metabarcoding analysis
JOURNAL Unpublished
REFERENCE 2 (bases 1 to 1081)
AUTHORS Sado,T., Fukuchi,T. and Miya,M.
TITLE Direct Submission
JOURNAL Submitted (27-AUG-2021) Contact:Tetsuya Sado Natural History Museum
& Institute, Chiba; 955-2 Aoba-cho, Chuo-ku, Chiba, Chiba 260-8682,
Japan URL :http://www2.chiba-muse.or.jp/NATURAL/
FEATURES Location/Qualifiers
source 1..1081
/organism="Acanthopagrus bifasciatus"
/organelle="mitochondrion"
/mol_type="genomic DNA"
/specimen_voucher="Kuroshio Biological Research Foundation
KBF-I 361"
/db_xref="taxon:767411"
/PCR_primers="fwd_name: L-708-12S, fwd_seq:
ttayacatgcaagtatccgc, rev_name: H-1784-16SG, rev_seq:
ttcagctttcccttgcggtac"
rRNA <1..894
/product="12S ribosomal RNA"
tRNA 895..967
/product="tRNA-Val"
rRNA 968..>1081
/product="16S ribosomal RNA"
ORIGIN
1 acccccgtga aaatgcccta cagttccccg cccggaaaca aggagccggt atcaggcaca
61 ttcaatttag cccacgacac cttgctcagc cacaccctca agggtactca gcagtgataa
121 accttgacac ataagtgaaa acttgaatca gttaaagcta agtagggccg gtaaaactcg
181 tgccagccac cgcggttata cgagaggccc aagttgttag aaatcggcgt aaagggtggt
241 taagaataag attaaaatta aagccgaaca tctttagtag ctgttatacg ctttcaaaga
301 caagaagccc aactgcgaaa gtagctttat attttctgaa cccacgaaag ctaaggtaca
361 aactgggatt agatacccca ctatgcttag ccgtaaacat cgacagttta ttacattttc
421 tgtccgcctg ggtactacaa gcattagctc aaaacccaaa ggacttggcg gtgctttaga
481 cccacctaga ggagcctgtt ctagaaccga tattccccgt tcaacctcac ctctccttgc
541 ctctcagcct atataccgcc gtcgttcagc ttaccctgtg aagggcaaaa agtaagcaaa
601 attggcactg cccagtacgt caggtcgagg tgtagtcaat ggagtgggaa gaaatgggct
661 acattccctt gtcttcaggg aactacgaat ggtgcactga aaatgtgtgc ctgaaggagg
721 atttagcagt aagtagtaat ttagaatatt ctactgaagc cggctcttaa gcgcgcacac
781 accgcccgtc actctccccg agactttaaa ttcacattaa ctaaaatatt aaatatcata
841 gaggggaggc aagtcgtaac atggtaagtg taccggaagg tgtacttgga aaaccagcgc
901 atagctaaac tagataaagc acctccctta cactgagaag atattcgtgc aaatcgaatt
961 gccctgagcc tatcagctag ccctctaaca aaaaacaaca cacccccatc aattaacccc
1021 caatgcactt acattaaatt aaacaaatca tttttccacc caagtatggg cgacagaaaa
1081 g
//
4. Click usage
import click
@click.command()
@click.option('--db_type', type=str, default="nucleotide", required=True, nargs=1,
help='Please input NCBI database type, default: "nucleotide", including: [pubmed, protein, nuccore, ipg, nucleotide, structure, genome, annotinfo, assembly, bioproject, biosample, blastdbinfo, books, cdd, clinvar, gap, gapplus, grasp, dbvar, gene, gds, geoprofiles, homologene, medgen, mesh, ncbisearch, nlmcatalog, omim, orgtrack, pmc, popset, proteinclusters, pcassay, protfam, pccompound, pcsubstance, seqannot, snp, sra, taxonomy, biocollections, gtr]')
@click.option('--term', type=str, default="", required=True, nargs=1,
help='Please input search term content, default: "Acanthopagrus 16S"')
@click.option('--max_record', type=str, default="100", required=True, nargs=1,
help='Please input max record number, default: "100", up to: 10000')
@click.option('--res_type', type=str, default="gb", required=False, nargs=1,
help='Please input result type, default: "gb", including: ["gb", "fasta", "gbwithparts", "gbcoll"]')
@click.option('--output', type=str, default="results.xls", nargs=1,
help='Please input output full name (path + name + extension). default="results.xls"')
def run(db_type, term, max_record, res_type, output):
"""
Description:
Search any term from all NCBI databases to obtain matched entries, and download all NCBI GenBank format files and sequences corresponding to accessory number in genbank directory, finally export all Species Latin names, Accessory Number, Sequence Length, Division, Collection Country, Collection Date, Collected Worker, Identified Worker, and Reference information, etc. of the search records as tabular files. \n
1. Get options and parameters help: \n
ncbi-parser --help \n
2. Example (simple information). Users only need to input the search term, and the default search is in NCBI nucleotide database: \n
ncbi-parser --term "Acanthopagrus 16S" --output results.xls \n
3. Example (complete information). Specify the NCBI database type, input the search term, specify the number of records to download and extract, and suggest setting a larger parameter max_record: \n
ncbi-parser --db_type nucleotide --term "Acanthopagrus 16S" --max_record 500 --res_type gb --output results.xls \n
"""
results_file = output
5. Pyinstaller usage
mamba create -n ncbiparser python=3.8
conda activate ncbiparser
which python
pip install biopython click
python ncbiparser.py --help
pip install pyinstaller
pyinstall -F ncbiparser.py -i favicon.ico
6. Package and publish ncbiparser to PyPI
6.1 Create setup.py file
#!/usr/bin/python
# _*_ coding:utf-8 _*_
from setuptools import setup, find_packages
### 1. Read the README.md contents
from os import path
this_directory = path.abspath(path.dirname(__file__))
with open(path.join(this_directory, 'README.md'), encoding='utf-8') as f:
long_description = f.read()
readme = 'ncbiparser/README.md'
### 2. Setup the package configure
setup(
# 2.1 Package information
name="ncbiparser",
version="1.0.0",
url="https://github.com/benben-miao/NCBI-Parser",
keywords=["CLI", "Biology", "NCBI", "Parser"],
description="Search and fetch the Species Latin names, Accessory Number, Sequence Length, Division, Collection Country, Collection Date, Collected Worker, Identified Worker, and Reference information, etc. of the search records as tabular files.",
long_description=long_description,
long_description_content_type='text/markdown',
download_url="https://pypi.org/project/ncbi-parser",
# 2.2 Developer information
author="benben-miao",
author_email="benben.miao@outlook.com",
maintainer="benben-miao",
maintainer_email="benben.miao@outlook.com",
license="MIT License",
# 2.3 Package configure
# include_package_data=True,
platforms="any",
install_requires=['biopython', 'click'],
# packages=find_packages(),
packages=['ncbiparser'],
entry_points={
'console_scripts': ['ncbiparser=ncbiparser.ncbiparser:run']
},
classifiers=[
"Programming Language :: Python :: 3",
"Operating System :: OS Independent",
],
data_files=[readme],
# package_data={
# '':['examples/*.xlsx']
# },
include_package_data=True
# exclude_package_data={
# }
)
### 3. Package build, test and publish
# 3.1 Install setuptools with wheel and twine
# pip install --upgrade setuptools wheel twine
# 3.2 Check the setup.py content
# python setup.py check
# 3.2 Build source code tarball
# python setup.py sdist
# 3.3 Build wheel package and test
# python setup.py bdist_wheel
# pip install dist\*.whl
# 3.4 Test package and uninstall test version
# ncbiparser --help
# pip uninstall ncbiparser
# 3.5 Publish the package to PyPI
# twine upload dist/*
6.2 Create the MANIFEST.in file
include *.py *.md
recursive-include examples *.sh *.py *.ipynb *.txt *.xlsx *.gbk *.fasta *.seq
6.3 Commands
### 3. Package build, test and publish
# 3.1 Install setuptools with wheel and twine
pip install --upgrade setuptools wheel twine
# 3.2 Check the setup.py content
python setup.py check
# 3.2 Build source code tarball
python setup.py sdist
# 3.3 Build wheel package and test
python setup.py bdist_wheel
pip install dist\*.whl
# 3.4 Test package and uninstall test version
ncbiparser --help
pip uninstall ncbiparser
# 3.5 Publish the package to PyPI
twine upload dist/*
Release files for ncbiparser 1.1.0
For a detailed explanation of source distributions (sdists) and built distributions (wheels), please see the package formats documentation.
Source distribution (sdist)
| File | Size | Uploaded | |
|---|---|---|---|
| ncbiparser-1.1.0.tar.gz | 8.7 kB | Details |
Built distribution (wheel)
| File | Interpreter | ABI | Platform | Reset |
|---|---|---|---|---|
| ncbiparser-1.1.0-py3-none-any.whl | Python 3 | none | any | Details |
Total release size: 23.8 kB
Release files / ncbiparser-1.1.0.tar.gz
| Download URL | ncbiparser-1.1.0.tar.gz |
|---|---|
| Size | 8.7 kB |
| Tags | Source |
|
SHA-256 checksum How to use checksums |
d39798c3a8ec38f9b392242e9f6351e75f366bbac78d6c17adc4257446f5093f
|
|
BLAKE2b-256 checksum How to use checksums |
cd291104b196e0456a5879054bb92607cde9cb8a1f71a4e52934087ded135f7f
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
No |
| Uploaded via |
twine/4.0.0 CPython/3.9.12
|
Release files / ncbiparser-1.1.0-py3-none-any.whl
| Download URL | ncbiparser-1.1.0-py3-none-any.whl |
|---|---|
| Size | 15.1 kB |
| Tags | Python 3 |
|
SHA-256 checksum How to use checksums |
75b29868a374051f2a1a9f766b512a488f8eef9903a3578bfc7de688f09c8bfd
|
|
BLAKE2b-256 checksum How to use checksums |
6b58b7cb0582a68c292ac981ce1d47c847d47981b0c2a124573ffced22cdea16
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
No |
| Uploaded via |
twine/4.0.0 CPython/3.9.12
|