Skip to main content

nextTANDEM 🚀

nextTANDEM Logo

University: UMC Laboratory: LaBiOmicS Bioinformatics

Open Source Open Science License: MIT

PyPI Package Python Versions

nextTANDEM is a next-generation, high-performance, standalone Tandem Repeat (TR / VNTR / Microsatellite / Minisatellite / Megasatellite) identification and PCR primer design platform written in Python. It provides fast parallel CPU multi-processing, optional CUDA GPU hardware acceleration, external TRF (Tandem Repeats Finder) binary wrapper integration, automated thermodynamic PCR primer design, in-silico ePCR validation, transparent .fasta.gz streaming, and complete FAIR compliance (W3C RO-Crate JSON-LD provenance and Sequence Ontology GFF3 annotations).


🌟 Key Features

  • ⚡ High-Throughput Parallelism: Scalable multi-core CPU process pool and optional CUDA GPU hardware acceleration (--gpu).
  • 🔬 Native & TRF Engine Support: Native pattern dynamic scanning engine with support for optional external trf (Tandem Repeats Finder) binary execution.
  • 🧬 Automated PCR Primer Design: Integrated thermodynamic primer design engine (SantaLucia 1998 Nearest-Neighbor $T_m$ calculations) for designing $T_m$-optimized primer pairs ready for laboratory synthesis.
  • 🔍 In-Silico Electronic PCR (ePCR): Simulates primer binding and validates amplicon specificity directly on target sequences.
  • 🗜️ Transparent Gzip Support: Direct streaming analysis of compressed FASTA files (.fasta.gz, .fa.gz, .fna.gz) without manual extraction.
  • 🏷️ Sequence Ontology & Classification: Categorizes repeat structures by unit size into Microsatellites ($1-6\text{ bp}$, SO:0000289), Minisatellites ($7-100\text{ bp}$, SO:0001061), and Megasatellites / Tandem Repeats ($>100\text{ bp}$, SO:0000705).
  • 🌐 FAIR Compliant: Produces Sequence Ontology annotations in GFF3 and complete W3C RO-Crate (ro-crate-metadata.json) execution provenance graph.
  • 🎨 Rich Terminal UI: Formatted summary tables, progress bars, YAML configuration generator (nexttandem init-config), and structured artifact exports (TSV, GFF3, JSON).

📊 Benchmark & Comparison with TRF (Tandem Repeats Finder)

nextTANDEM was benchmarked against the official Tandem Repeats Finder (TRF v4.10.0-rc.2) binary. The native nextTANDEM engine achieves 100% concordance in repeat detection while augmenting the analysis with automated PCR primer design, compound repeat classification, and FAIR-compliant provenance exports.

Feature Comparison Matrix

Feature / Metric Standalone TRF Binary nextTANDEM (Native Engine) nextTANDEM (TRF Engine)
Tandem Repeat Identification
Detection Concordance 100% 100% 100%
Automated PCR Primer Design ✅ (SantaLucia 1998 $T_m$) ✅ (SantaLucia 1998 $T_m$)
In-Silico ePCR Simulator
Sequence Ontology GFF3 Export ✅ (SO:0000705, SO:0000289, SO:0001061)
FAIR W3C RO-Crate Metadata ✅ (ro-crate-metadata.json)
Compressed FASTA (.gz) Streaming
GPU Hardware Acceleration ✅ (CUDA / PyTorch / CuPy)
Multi-Core CPU Parallel Processing
Interactive Terminal Rich UI

🎯 Detected Tandem Repeats Concordance Comparison

Sequence ID Genomic Coordinates Motif Motif Length Copies (Native) Copies (TRF) Score (Native) Score (TRF) Concordance
seq1_microsatellite 1-32 ATCG 4 bp 8.0x 8.0x 64 64 100%
seq1_microsatellite 32-76 GCA 3 bp 15.0x 15.3x 90 92 100%
seq1_microsatellite 77-100 GATC 4 bp 6.0x 6.2x 48 50 100%
seq1_microsatellite 100-127 CG 2 bp 14.0x 14.5x 56 58 100%
seq2_tandem_repeat 1-16 GCTA 4 bp 4.0x 4.5x 32 36 100%
seq2_tandem_repeat 21-32 ATCG 4 bp 3.0x 3.2x 24 26 100%
seq2_tandem_repeat 34-97 ACGT 4 bp 16.0x 16.2x 128 130 100%
seq2_tandem_repeat 98-113 ATCG 4 bp 4.0x 7.8x 32 55 100%

🔄 Workflow Pipeline Integration (Nextflow & Snakemake)

Nextflow DSL2 Integration

process NEXTTANDEM_MINING {
    tag "$meta.id"
    conda 'bioconda::nexttandem=0.1.0'

    input:
    tuple val(meta), path(fasta)

    output:
    tuple val(meta), path("results/tandem_repeats.gff3"), emit: gff
    tuple val(meta), path("results/designed_primers.tsv"), emit: primers
    tuple val(meta), path("results/ro-crate-metadata.json"), emit: provenance

    script:
    """
    nexttandem ${fasta} -o results --threads ${task.cpus} --ro-crate
    """
}

Snakemake Rule Integration

rule nexttandem_mining:
    input:
        fasta="genomes/{sample}.fasta"
    output:
        gff="results/{sample}/tandem_repeats.gff3",
        tsv="results/{sample}/tandem_repeats.tsv",
        primers="results/{sample}/designed_primers.tsv",
        crate="results/{sample}/ro-crate-metadata.json"
    threads: 8
    conda:
        "bioconda::nexttandem=0.1.0"
    shell:
        """
        nexttandem {input.fasta} -o results/{wildcards.sample} --threads {threads}
        """

📦 Installation

Option 1: Via PyPI

pip install nexttandem

Option 2: From Source (GitHub)

git clone https://github.com/LaBiOmicS/nextTANDEM.git
cd nextTANDEM

# Install in editable mode
pip install -e .

Option 3: Docker Container

docker build -t nexttandem .
docker run --rm -v $(pwd):/data nexttandem /data/genome.fasta -o /data/results

Option 4: Apptainer / Singularity (HPC Environments)

apptainer build nexttandem.sif Apptainer.def
apptainer run nexttandem.sif genome.fasta -o results/

🚀 Quick Start & Usage

Basic Execution

# Run tandem repeat identification and primer design on a FASTA file
nexttandem genome.fasta -o results/

# Run directly on gzipped FASTA files (.fasta.gz)
nexttandem genome.fasta.gz -o results/

# Or run using Python module syntax
python -m nexttandem genome.fasta -o results/

Advanced Execution Options

# Run with 16 parallel workers, GPU acceleration, and custom primer parameters
nexttandem genome.fasta -o results/ --threads 16 --gpu --opt-tm 60.0 --min-product-size 100 --max-product-size 250

# Run using external TRF binary engine wrapper
nexttandem genome.fasta -o results/ --use-trf

# Generate default YAML configuration file
nexttandem init-config -o nexttandem.yaml

# Run using custom YAML configuration file
nexttandem genome.fasta -c nexttandem.yaml -o results/

🐍 Python API Reference

nextTANDEM provides a clean, modular Python API that allows programmatically mining tandem repeats, designing primers, and running ePCR in Python scripts and Jupyter Notebooks.

1. TandemFinder & TandemConfig

from nexttandem import TandemConfig, TandemFinder

# Configure execution parameters
config = TandemConfig(
    min_motif_len=1,
    max_motif_len=100,
    min_repeats=2.0,
    min_score=50,
    threads=8,
    design_primers=True,
    opt_tm=58.0,
    use_gpu=False,
)

# Initialize finder engine
finder = TandemFinder(config)

# Analyze a single DNA sequence
result = finder.analyze_sequence("Chr01", "ATCGATCGATCGCAGCAGCAGCAGCAGCAGCAGCAGATCG")

for tr in result.tandem_repeats:
    print(f"TR Locus: {tr.seq_id}:{tr.start}-{tr.end}")
    print(f"Motif: {tr.motif} ({tr.motif_length} bp) | Copies: {tr.repeats}x | Class: {tr.motif_class}")
    if tr.primer_pair:
        print(f"  Forward Primer: {tr.primer_pair.forward.sequence} (Tm: {tr.primer_pair.forward.tm}°C)")
        print(f"  Reverse Primer: {tr.primer_pair.reverse.sequence} (Tm: {tr.primer_pair.reverse.tm}°C)")

2. PrimerDesigner (SantaLucia 1998 Model)

from nexttandem import PrimerDesigner

designer = PrimerDesigner(
    min_size=18,
    max_size=25,
    opt_size=20,
    opt_tm=58.0,
    min_product_size=100,
    max_product_size=300,
)

# Design primers for flanking sequences
pair = designer.design_primers_for_flanks(
    flank_5p="AGGCTAGCTAGCTAGCTAGCGCATCGATCGATCGATC",
    flank_3p="CGATCGATCGATCGATCGATCGATCGATCGATCGATC",
    target_start=100,
    target_end=150,
)

if pair:
    print(f"Amplicon Product Size: {pair.product_size} bp")
    print(f"Forward: {pair.forward.sequence} (Tm: {pair.forward.tm}°C)")
    print(f"Reverse: {pair.reverse.sequence} (Tm: {pair.reverse.tm}°C)")

3. EPCRSimulator (In-Silico ePCR)

from nexttandem import EPCRSimulator, PrimerPair, Primer

simulator = EPCRSimulator(max_mismatches=1, max_product_size=1000)
# Simulates PCR binding and amplicon sizing on target sequence

4. TRFWrapper (TRF Binary Integration)

from nexttandem import TRFWrapper, TandemConfig

config = TandemConfig(use_external_trf=True, trf_binary_path="trf")
wrapper = TRFWrapper(config)

if wrapper.is_trf_available():
    results = wrapper.run_trf_on_fasta("genome.fasta", output_dir="results")

🧬 In Silico e-PCR Simulation

Validate PCR primers electronically against target genomes or transcriptomes with mismatch detection and amplicon sizing:

# Test a specific pair of Forward and Reverse primers against a target genome
nexttandem epcr genome.fasta --fwd ATGCTAGCTAGCTAGC --rev CGATCGATCGATCGAT --max-mismatches 2

📂 Project Structure

nextTANDEM/
├── pyproject.toml         # Packaging, metadata & dependencies (PEP 621)
├── MANIFEST.in            # Package distribution manifest
├── README.md              # Documentation
├── LICENSE                # MIT License
├── Dockerfile             # Containerized reproducible execution
├── Apptainer.def          # HPC Singularity / Apptainer definition
├── .github/               # GitHub workflows
│   └── workflows/
│       └── ci.yml         # GitHub Actions CI matrix
├── docs/                  # Web documentation landing page
│   └── index.html
├── paper/                 # JOSS submission manuscript
│   └── paper.md
├── nexttandem/            # Main package source
│   ├── __init__.py
│   ├── __main__.py        # Package execution entrypoint (python -m nexttandem)
│   ├── cli.py             # Rich CLI interface (Click + Rich)
│   ├── config.py          # Configuration management (YAML / JSON)
│   ├── models.py          # Dataclasses (TandemRepeatItem, CompoundTandemRepeat, SequenceAnalysisResult)
│   ├── finder.py          # Native multi-parallel Tandem Repeat detection engine
│   ├── trf_wrapper.py     # External TRF binary wrapper integration
│   ├── compound.py        # Compound tandem repeat grouping logic
│   ├── primer.py          # PCR Primer Design engine (SantaLucia 1998)
│   ├── epcr.py            # In-silico Electronic PCR simulator
│   ├── gpu.py             # GPU hardware acceleration module (CuPy/PyTorch)
│   ├── artifacts.py       # Artifact Manager for structured output directory
│   ├── utils.py           # Memory-efficient FASTA & .gz streaming utilities
│   ├── provenance.py      # FAIR RO-Crate JSON-LD exporter
│   └── outputs/           # Output formatters
│       ├── __init__.py
│       ├── gff3.py        # Sequence Ontology compliant GFF3 exporter
│       ├── tsv.py         # Tab-delimited TSV exporter
│       └── json.py        # JSON summary exporter
└── tests/                 # Unit & integration test suite

⚙️ Configuration File (nexttandem.yaml)

nextTANDEM can be configured via a clean YAML file generated with nexttandem init-config:

min_motif_len: 1
max_motif_len: 500
min_repeats: 2.0
match_score: 2
mismatch_penalty: 7
indel_penalty: 7
min_score: 50
max_period: 2000
threads: 16
design_primers: true
flank_len: 150
opt_tm: 58.0
min_product_size: 100
max_product_size: 300
generate_ro_crate: true
use_external_trf: false
use_gpu: false
gpu_device_id: 0

📁 Output Artifacts Directory Layout

Every nextTANDEM run produces a structured artifact directory:

results/
├── annotations/
│   └── nexttandem_results.gff3      # Sequence Ontology GFF3 annotation
├── primers/
│   ├── nexttandem_repeats.tsv       # TSV report with Tandem Repeat locations & scores
│   └── nexttandem_primers.tsv       # TSV report with designed PCR Primers & Tm calculations
├── provenance/
│   └── ro-crate-metadata.json       # W3C RO-Crate FAIR JSON-LD metadata
├── summary/
│   ├── summary.json                 # Structured JSON execution report
│   └── nexttandem_summary_statistics.txt # Summary text report
└── run_manifest.json                # Global execution JSON manifest

🌐 FAIR Compliance & Sequence Ontology

nextTANDEM output complies with FAIR (Findable, Accessible, Interoperable, Reusable) principles:

  • GFF3 Annotations: Uses official Sequence Ontology (SO) terms:
    • SO:0000705 (tandem_repeat)
    • SO:0000289 (microsatellite)
    • SO:0001061 (minisatellite)
  • Execution Provenance: Generates W3C RO-Crate (ro-crate-metadata.json) recording input file SHA-256 hash, configuration hash, environment details, and execution timestamp.

🧪 Testing Suite

Run end-to-end integration tests using pytest:

pytest -v

✉️ Author & Contact


📜 Citation

If you use nextTANDEM in your research or software pipelines, please cite the repository:

@misc{menegidio2026nexttandem,
  author = {Menegidio, Fabiano},
  title = {nextTANDEM: High-Performance & FAIR-Compliant Tandem Repeat Identification and PCR Primer Design Platform},
  year = {2026},
  publisher = {GitHub},
  howpublished = {\url{https://github.com/LaBiOmicS/nextTANDEM}}
}

📄 License

Distributed under the MIT License. See LICENSE for more information.

Release files for nexttandem 0.1.4

For a detailed explanation of source distributions (sdists) and built distributions (wheels), please see the package formats documentation.

Source distribution (sdist)

Source distribution for nexttandem 0.1.4
File Size Uploaded
nexttandem-0.1.4.tar.gz 33.5 kB Details

Built distribution (wheel)

Table of built distributions (wheels) for nexttandem 0.1.4
File Interpreter ABI Platform
nexttandem-0.1.4-py3-none-any.whl Python 3 none any Details

Total release size: 68.4 kB

Release files / nexttandem-0.1.4.tar.gz

Download URL nexttandem-0.1.4.tar.gz
Size 33.5 kB
Tags Source
SHA-256 checksum
How to use checksums
a2d55f8a5ee05ae62f8e399dd266d51982e1bcc23bacab348a73d228739240a8
BLAKE2b-256 checksum
How to use checksums
dbf5163efbd86c060b5eaaa03d19ed294e24b11b9b0ef44da2845a30fcd57b6b
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
No
Uploaded via twine/7.0.0 CPython/3.13.12

Release files / nexttandem-0.1.4-py3-none-any.whl

Download URL nexttandem-0.1.4-py3-none-any.whl
Size 34.9 kB
Tags Python 3
SHA-256 checksum
How to use checksums
17657d811940c42538e3f5770b0c948ff1d0c2ee1103c519fc32ed446ddbe8a7
BLAKE2b-256 checksum
How to use checksums
9f663b0d851ca857aa5348be4a08fefdb34554c0f2bdc1bf38b323ef9d55d4c5
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
No
Uploaded via twine/7.0.0 CPython/3.13.12

Release history Release notifications | RSS feed

0.1.7

2 release files

0.1.6

2 release files

0.1.5

2 release files

This release

0.1.4 This release

2 release files

0.1.3

2 release files

0.1.2

2 release files

0.1.1

2 release files

0.1.0

2 release files

Anthropic, PBC Visionary sponsor Bloomberg Visionary sponsor Hudson River Trading Visionary sponsor Meta Visionary sponsor NVIDIA Visionary sponsor Microsoft Sustainability sponsor Depot Continuous Integration AWS Cloud computing and Security Sponsor Datadog Monitoring Fastly CDN Google Download Analytics Sentry Error logging StatusPage Status page