Skip to main content

NoetherSolve

https://github.com/SolomonB14D3/noethersolve · https://solomonb14d3.github.io/noethersolve

Paper: Breaking Frozen Priors Paper: NoetherSolve Toolkit

Automated scientific discovery: find where models are wrong, build tools that give the right answer, and serve them to any AI agent.

The pipeline: find gaps → flip facts → build tool → add to MCP server. Every tool we build makes every connected agent smarter.

NoetherSolve starts by finding where LLMs are confidently wrong. It generates candidates, verifies them numerically, and measures whether the model already knows them. When it doesn't — that's where new science lives. The system discovers the answer, builds a verified computational tool for it, and exposes that tool via Model Context Protocol (MCP) so any AI agent can call it at inference time.

This is better than embedding knowledge in weights. Adapters trained on domain facts improve general truth preference (+0.10 MC2 on TruthfulQA, statistically significant), and orthogonal adapters (routed per-cluster) achieve 100% across 48 domains — but they can't be naively stacked without interference. Tools scale without constraints: each new tool is independent, verified, and callable on demand. The agent doesn't need to memorize that the Riemann Hypothesis is open — it calls check_conjecture("Riemann") and gets the verified answer.

46 tools currently exposed via MCP. 30 are calculators — verified computational engines that derive answers from first principles (PID controller simulation, transaction isolation analysis, quantum circuit simulation, stability analysis, conservation law monitoring, genetic design, chemical auditing, and more). 16 are lookup tables — reference databases for mathematical conjectures, complexity theory, proof barriers, benchmark scores, LLM science claims, biochemistry, organic chemistry, and quantum mechanics. Calculators scale indefinitely; lookups are faster but finite. Together they cover physics, math, genetics, control systems, databases, quantum computing, pharmacogenomics, chemistry, cryptography, economics/finance, distributed systems, networking, operating systems, biochemistry, organic chemistry, quantum mechanics, and LLM science.

The method is domain-agnostic. We've applied it to fluid dynamics, electromagnetism, chemical kinetics, Hamiltonian mechanics, Navier-Stokes regularity, knot theory, genetics therapeutics (7 domains covering CRISPR design through clinical translation), unsolved mathematics (6 domains covering Millennium Problems through computational complexity), LLM science (6 domains), programming languages (6 domains), 9 STEM domains (chemistry, cryptography, economics/finance, distributed systems, networking, operating systems, database internals, quantum computing, control systems), and 3 science domains (biochemistry, organic chemistry, quantum mechanics). Any field where you can verify a claim and build a checker is fair game.

Paper

Breaking Frozen Priors: Teaching Language Models to Discover Conservation Laws from Numerical Simulation (Sanchez, 2026) DOI: 10.5281/zenodo.19017290

Three-phase pipeline transforms a frozen oracle (margin -77.5 +/- 1.7) into a ranking engine (Spearman rho = 0.932 from baseline -0.143). Novel Q_f invariant family verified across chaotic vortex systems and extended to continuous 2D/3D Euler equations. The LLM gap pointed directly at the physics: the model's blind spot on weighted distance sums led to the discovery of stretch-resistant invariants relevant to 3D Navier-Stokes regularity. See paper/breaking_frozen_priors.pdf.

NoetherSolve Toolkit: Conservation Law Monitoring, Discovery, and Scientific Auditing Across Physics, Genetics, and Mathematics (Sanchez, 2026) DOI: 10.5281/zenodo.19029880

Forty-three tools organized across multiple tiers: 6 physics tools (conservation monitors, integrator validator, chemical auditor, EM monitor, Hamiltonian validator, invariant learner), 7 genetics tools (sequence auditor, CRISPR scorer, pipeline validator, aggregation predictor, splice scorer, pharmacokinetics checker, fact auditor), 7 unsolved mathematics tools (complexity auditor, conjecture checker, proof barrier checker, number theory verifier, reduction validator, PDE regularity checker, knot monitor), 1 LLM science tool (claims auditor with benchmark checker and scaling calculator), 3 systems tools (PID controller, transaction isolation, quantum circuit simulator), and 6 STEM calculators (chemistry, cryptography, finance, distributed systems, networking, operating systems). Q_f monitors detect corruption at 100x lower noise than standard H/Lz monitors. 173 validation test cases across all tools, 100% catch rate. 1252 tests with physics-enforcing pre-commit hook. See paper/noethersolve_toolkit.pdf.


How It Works (Plain English)

An AI model is trained on everything humans have written. That means it knows what we know, but it also shares our blind spots. Where the collective literature is thin or wrong, the model is thin or wrong.

NoetherSolve exploits this in four steps:

  1. Find gaps. Propose claims about how systems behave. Verify them numerically. Ask the model: did you already know this? If the model is confidently wrong, that's a gap — and gaps in model knowledge point to gaps in human knowledge, because the model was trained on human knowledge.
  2. Flip facts. Train lightweight adapters that flip the model's answer from wrong to right, without degrading anything it already knows. Orthogonal adapters (one per concept cluster, routed at inference) achieve 100% across all 48 domains (555 facts) with 0% MMLU degradation. Cross-domain joint training blends multiple domains into a single adapter with fair results (H 14/16, NS 10/16, Knot 11/16, Chem 13/16 from ONE adapter). The constraint: adapters can't be naively stacked — they must be routed or blended from scratch, never merged after training. This is the path to fixing small models directly.
  3. Build tools. Each discovery becomes a standalone computational tool — a verified calculator that derives answers from first principles. Tools scale without routing constraints and work for any model.
  4. Add to MCP server. Expose every tool via Model Context Protocol so any AI agent (Claude, GPT, local models) can call them at inference time. The agent doesn't need to memorize facts — it calls the tool and gets the verified answer.

The result: every gap we find makes every connected agent smarter. The 46 tools currently served cover physics, genetics, mathematics, complexity theory, pharmacogenomics, control systems, databases, quantum computing, chemistry, cryptography, economics/finance, distributed systems, networking, operating systems, biochemistry, organic chemistry, quantum mechanics, and LLM science.


MCP Server — Give Any AI Agent 43 Verified Tools

The MCP server exposes all NoetherSolve tools to any AI agent that supports Model Context Protocol. One line of config, 46 tools available: 30 calculators + 16 lookup tables.

Setup for Claude Code

The project includes .mcp.json — Claude Code auto-discovers it when you open the project. No manual config needed.

Or install globally and use the entry point:

pip install noethersolve[mcp]
noethersolve-mcp  # starts the server

Available Tools (46)

Category Tools Examples
Conservation monitors 4 check_vortex_conservation, check_hamiltonian_system, check_em_conservation, discover_conservation_law
Mathematics 10 check_conjecture, check_complexity_inclusion, check_proof_barriers, verify_goldbach, check_sobolev_embedding
Genetics/therapeutics 5 score_crispr_guide, audit_dna_sequence, predict_protein_aggregation, validate_therapy_pipeline
Pharmacogenomics 2 audit_drug_interactions, check_pharmacogenomics
LLM science 4 check_llm_claim, chinchilla_scaling, check_benchmark_score, audit_llm_claims
Chemical kinetics 1 audit_chemical_network
Knot theory 1 check_knot_invariants
Number theory 4 verify_goldbach, verify_collatz, check_abc_triple, analyze_prime_gaps
Chemistry 3 calc_nernst, calc_buffer_ph, calc_crystal_field
Cryptography 3 calc_security_level, calc_birthday_bound, calc_cipher_mode
Economics/Finance 3 calc_black_scholes, calc_put_call_parity, calc_nash_equilibrium
Distributed systems 3 calc_quorum, calc_byzantine, calc_vector_clock
Networking 3 calc_bandwidth_delay, calc_subnet, calc_tcp_throughput
Operating systems 3 calc_page_table, calc_scheduling, calc_deadlock
Biochemistry 1 check_biochemistry
Organic chemistry 1 check_organic_chemistry
Quantum mechanics 1 check_quantum_mechanics

Every tool returns verified results from curated reference databases — not model guesses. When an agent calls check_conjecture("Riemann"), it gets the actual status (OPEN), the key facts, common errors, and references. No hallucination possible.

Why MCP instead of fine-tuning?

We tried both. Adapters trained on 555 domain facts improve truth preference (+0.10 MC2 on TruthfulQA), and orthogonal adapters (routed per-cluster at inference) achieve 100% across all 48 domains with 0% MMLU degradation. Cross-domain joint training also works — a single difficulty-weighted adapter lifts 4 domains simultaneously. But adapters can't be naively stacked: combining 37+ adapters by weight averaging destroys general knowledge (-43% MMLU), and a unified adapter on 244+ facts collapses. The key insight is route, never stack — each adapter must be routed to its domain at inference, never merged. Tools don't have these constraints:

  • No routing needed. Each tool is independent. Adding tool #43 doesn't degrade tools #1-42 and requires no inference-time routing logic.
  • No capacity limits. A tool can encode arbitrarily complex logic.
  • Verified correctness. 1252 tests enforce correctness. An adapter can only shift probabilities; a tool returns the exact right answer.
  • Model-agnostic. Any agent that speaks MCP can use these tools. Adapters are tied to one model's vocabulary.

Two complementary paths. Adapter blending (joint training from scratch on mixed data) is the path to fixing small models directly — a single difficulty-weighted adapter lifts 4 domains simultaneously (H 14/16, NS 10/16, Knot 11/16, Chem 13/16), and orthogonal routing gets 16/16 per domain with 0% MMLU degradation. MCP tools are the path to making any model a powerhouse through tool use — each tool is independent, verified, and callable on demand, no routing required. Adapters change what the model knows; tools change what the model can do.


What It Does (Technical)

NoetherSolve runs a dual-filter pipeline. The "oracle" is a base LLM scored by log-probability: for each candidate fact, we compare log P(true answer | context) against log P(best distractor | context). Positive margin means the model knows it; negative means it doesn't.

Hypothesis (expression)
       │
       ▼
 Numerical checker          ← Is this quantity actually conserved?
 (RK45 integration,           frac_var = σ/|mean| < threshold
  frac_var test)
       │ PASS
       ▼
 Oracle filter              ← Does the model already know it?
 (log-prob margin,            margin = log P(truth) − log P(best distractor)
  base LLM + adapter stack)
       │
       ├─ PASS  → DUAL-PASS: known quantity, archive it
       │
       └─ FAIL  → NEW SCIENCE: model has never seen this
                    │
                    ▼
              Train adapter  ← Teach the discovery to the model
              (hinge loss,     25 examples generated per candidate
               logit-space)
                    │
                    ├─ margin flips → KNOWLEDGE INJECTED: adapter joins the stack
                    │                  (all future candidates evaluated with this knowledge)
                    │
                    └─ margin stays → HARD GAP: log it, try different approach next run

Adapters stack within a run — each successful discovery makes the oracle smarter for every subsequent candidate. After the main sweep, a confidence-driven resampling pass retries borderline failures (margin between -5 and 0) with the full adapter stack. Candidates that were just short of flipping often get rescued once the model has absorbed neighboring discoveries. Survivors get promoted to high-priority in the open questions queue for the next run.

Escalation for hard domains
  1. Single-pass — one adapter for the whole domain. Works for clean domains (chemical kinetics: 0/16 to 16/16 with distractor fix).

  2. Staged training — group facts into clusters, train sequentially, verify zero regression at each stage. Solved Hamiltonian mechanics (1/16 to 16/16 in 5 stages).

  3. Orthogonal adapters — when staged training plateaus because facts interfere within a single adapter, train separate specialist adapters per concept cluster. Each adapter learns one cluster without fighting the others. Route facts to their specialist at inference. Solved NS regularity (6/16 staged to 16/16 with orthogonal cluster adapters).

  4. Cross-domain joint training — train a single adapter on multiple domains simultaneously. Difficulty-weighted sampling achieves the best transfer:

    Method Hamiltonian NS Knot Chemical
    No adapter 1/16 0/16 1/16 0/16
    Basic joint 16/16 6/16 10/16 11/16
    Domain-balanced 16/16 6/16 11/16 11/16
    Difficulty-weighted 14/16 10/16 11/16 13/16
    Anchored joint 16/16 9/16 11/16 12/16

    A single jointly-trained adapter lifts all 4 domains simultaneously. Difficulty-weighted sampling (oversample hard facts) gives the best result on the hardest domain (NS: 0 to 10/16). Conservation knowledge transfers across physics and pure math.

Token-length bias

Some facts are unlearnable because the base model prefers shorter token sequences. If a distractor is shorter than the correct answer (e.g., "k × [A]" vs "k × [A] × [B] where k is the rate constant"), no amount of adapter training will flip the margin. Fix by rephrasing: shorten the truth and lengthen the distractors so they're clearly wrong and roughly the same length. This flipped the last chemical kinetics holdout from -3.8 to +4.3 and rescued ns03 from -44 to +242.8.

Never stack adapters — but blending works

Stacking fails. Training a specialist on gap facts and layering it on top of a joint adapter at inference destroyed the joint adapter's wins (8/16 → 5/16). The specialist overwrites what the joint adapter learned. Never combine adapter weights by averaging or stacking at inference.

Blending works. Cross-domain joint training (difficulty-weighted sampling) produces a single adapter that lifts multiple domains simultaneously: Hamiltonian 14/16, NS 10/16, Knot 11/16, Chemical 13/16 — all from ONE adapter. Not as good as orthogonal routing (which gets 16/16 per domain), but a viable middle ground when routing complexity is a concern.

The distinction: training one adapter from scratch on mixed data = blending (works). Combining separately trained adapters at inference = stacking (fails).

Two paths forward. Adapter blending is the path to improving small models directly — embed corrected knowledge into the weights so even a 4B model gets the answer right without tool calls. MCP tools are the path to making any model a powerhouse — the model doesn't need to know the answer, it just needs to know which tool to call. Both paths are productive; the choice depends on whether you're optimizing the model or the system.


Toolkit — Practical Tools Built from Discoveries

The pipeline's discoveries become standalone tools that work without any LLM. Install: pip install noethersolve (or pip install -e . for development).

Conservation Monitors

Drop into any simulation loop. Track standard invariants (H, Lz, momentum) plus AI-discovered quantities (Q_f family, R_f ratio, Wegscheider cyclicity).

from noethersolve import VortexMonitor

monitor = VortexMonitor(circulations=[1.0, -0.5, 0.3])
monitor.set_initial(positions)

for step in simulation:
    state = integrator.step()
    report = monitor.check(state)
    if report.worst_drift > 1e-3:
        print(f"WARNING: {report.worst_name} drifted {report.worst_drift:.2e}")

Three built-in monitors: VortexMonitor (2D point-vortex), ChemicalMonitor (reaction networks with Wegscheider cyclicity, entropy production, Lyapunov function), GravityMonitor (N-body with Q_f on pairwise distances).

Integrator Validator

Validates your ODE solver configuration before you run a long simulation. Checks whether conservation laws are preserved and suggests fixes.

from noethersolve import validate_integrator

report = validate_integrator(
    rhs=my_vortex_rhs,
    y0=positions.ravel(),
    t_span=(0, 100),
    system="vortex",
    circulations=[1.0, -0.5, 0.3],
    rhs_args=(circulations,),
    rtol=1e-8,
)
print(report)
# ============================================================
#   Integrator Validation: PASS
# ============================================================
#   PASSED (12):
#     H                          frac_var=9.30e-09
#     Lz                         frac_var=4.80e-09
#     Q_linear                   frac_var=2.53e-03
#     ...

Also supports compare_configs() to test multiple solver settings side-by-side, and custom invariants via invariants={"energy": lambda y: compute_energy(y)}.

Chemical Network Auditor

Checks thermodynamic consistency of a reaction network without running a simulation. Pure algebraic checks on the stoichiometry and rate constants.

from noethersolve import audit_network

report = audit_network(
    species=["A", "B", "C"],
    stoichiometry=[[-1, 1, 0, 0], [1, -1, -1, 1], [0, 0, 1, -1]],
    rate_constants=[0.5, 0.3, 0.4, 0.2],
    reactant_matrix=[[1, 0, 0, 0], [0, 1, 1, 0], [0, 0, 0, 1]],
    reverse_pairs=[(0, 1), (2, 3)],
)
print(report)
# Shows: conservation laws, Wegscheider cycle products, detailed balance
# ratios, entropy production, and warnings if anything is inconsistent.

Catches: Wegscheider cyclicity violations, missing conservation laws, non-physical rate constants, negative entropy production (second law violation).

EM Field Monitor

Monitors electromagnetic field simulations for conservation of standard and obscure invariants: energy, momentum, optical chirality (Zilch Z⁰, Lipkin 1964), helicity, super-energy (Chevreton tensor), zilch vector.

from noethersolve import EMMonitor

monitor = EMMonitor(N=64, L=2*np.pi)
monitor.set_initial(E_fields, B_fields)  # 3-tuples of 3D arrays

for step in simulation:
    E, B = maxwell_solver.step()
    report = monitor.check(E, B)
    if report.worst_drift > 1e-6:
        print(f"WARNING: {report.worst_name} drifted {report.worst_drift:.2e}")

Catches: numerical dissipation, wrong boundary conditions, missing terms in Maxwell solvers. Spectral curls computed internally via FFT.

Hamiltonian System Validator

Validates that an ODE integrator preserves the symplectic structure of Hamiltonian systems. Goes beyond energy to check Liouville's theorem (phase-space volume) and the first Poincaré integral invariant (∮ p dq).

from noethersolve import kepler_2d

monitor = kepler_2d(mu=1.0)  # built-in Kepler problem
report = monitor.validate(
    z0=np.array([1.0, 0.0, 0.0, 0.8]),  # elliptical orbit
    T=100.0, rtol=1e-10,
)
print(report)
# Shows: energy, angular_momentum, LRL_magnitude,
#        liouville_volume, poincare_invariant — all PASS/WARN/FAIL

Built-in systems: harmonic_oscillator, kepler_2d (with angular momentum and Laplace–Runge–Lenz vector), henon_heiles, coupled_oscillators. Or bring your own H(z) and ∇H(z) via HamiltonianMonitor(H=..., dH=..., n_dof=...).

Invariant Learner

Automatically discovers new conserved quantities from trajectory data. Optimizes over 12 basis functions to find f(r) that minimizes fractional variation of Q_f = Σᵢ<ⱼ wᵢwⱼ f(rᵢⱼ) along one or more trajectories.

from noethersolve import InvariantLearner

learner = InvariantLearner()
result = learner.learn_from_positions(
    position_trajectories=[trajectory],  # shape (n_steps, N, dim)
    weights=[1.0, -0.5, 0.3],           # vortex circulations
)
print(result)
# Shows: optimal f(r) = 0.924·e^(-r) + 0.186·sin(r) + ...
#        40% improvement over single-basis e^(-r)
#        Individual basis losses ranked

Three input modes: learn_from_positions (raw coordinates), learn_from_distances (pairwise distance time series), learn_from_field (continuous 2D vorticity fields via FFT convolution).

Fact Quality Auditor

Checks oracle fact files (*_facts.json) for token-length bias and distractor quality issues before you waste training cycles. Token-length bias was the #1 blocker across 4 domains (14+ facts needed rephrasing).

from noethersolve import audit_facts

report = audit_facts("problems/3body_conservation_facts.json")
print(report)
# ============================================================
#   Fact Audit: WARN (2 issues)
# ============================================================
#   3b03_angular           LENGTH_BIAS  ratio=0.63  HIGH
#   3b05_visviva           LENGTH_BIAS  ratio=0.68  HIGH
#   3b01_energy            LENGTH_BIAS  ratio=0.82  MODERATE
#   ...

Catches: truth longer than shortest distractor (ratio < 0.7 = HIGH, < 0.9 = MODERATE), distractors that are substrings of the truth, identical distractors. Run this on every new fact file before training.

Knot Invariant Monitor

Verifies knot invariants under Reidemeister moves. Checks which quantities are preserved (Jones polynomial) vs which change (writhe, bracket polynomial) when you add/remove twists and crossings.

from noethersolve import KnotMonitor, trefoil

monitor = KnotMonitor(trefoil())
report = monitor.validate()
print(report)
# ============================================================
#   Knot Invariant Report: trefoil — PASS
# ============================================================
#   R1 (add twist):
#     writhe              EXPECTED_CHANGE  3 → 4
#     bracket_polynomial  EXPECTED_CHANGE  (changed by -A^{-3})
#     jones_polynomial    PRESERVED        ✓
#   R2, R3: all quantities preserved  ✓

Built-in knots: unknot(), trefoil(), figure_eight_knot(). Reidemeister moves: apply_r1(knot, sign), apply_r1_remove(knot).

Genetics Therapeutics Tools

Six tools for genetics therapeutics design — sequence auditing, CRISPR guide scoring, pipeline consistency validation, protein aggregation prediction, splice site scoring, and pharmacogenomic interaction checking.

Sequence Design Auditor — checks DNA/RNA for therapeutic design pitfalls:

from noethersolve import audit_sequence

report = audit_sequence("ATGCGATCGAATAAACGATTTTTCG")
print(report)
# CpG density, GC content, homopolymers, cryptic splice sites,
# poly-A signals, self-complementarity — with severity levels

CRISPR Guide RNA Scorer — scores guides for on-target activity and off-target risk:

from noethersolve import score_guide, check_offtarget_pair

report = score_guide("GAGTCTAGCAGTCTAGCACG")
print(f"Activity: {report.activity_score}/100, Off-target: {report.offtarget_risk}")

# Compare guide to potential off-target site
pair = check_offtarget_pair("GAGTCTAGCAGTCTAGCACG", "GAGTCTAGCAGTCTAGCACC")
print(f"Seed mismatches: {pair['seed_mismatches']}, Risk: {pair['risk_level']}")

Therapeutic Pipeline Validator — cross-domain consistency checker:

from noethersolve import validate_pipeline, TherapyDesign

design = TherapyDesign(
    modality="aav",
    target_tissue="liver",
    transgene_size_kb=4.5,
    vector_serotype="AAV8",
    promoter="TBG",
    route="iv",
    payload_type="gene_replacement",
)
report = validate_pipeline(design)
print(report)
# Checks: vector capacity, serotype-tissue, promoter-tissue,
# route-tissue, modality-payload, redosing immunity, safety monitoring

Protein Aggregation Predictor — predicts aggregation risk from amino acid sequence:

from noethersolve import predict_aggregation

report = predict_aggregation("MILVFAILVILMFAILVM")
print(report)
# APR detection (AGGRESCAN), hydrophobicity (Kyte-Doolittle),
# hydrophobic patches, net charge, low-complexity regions

Splice Site Scorer — scores donor/acceptor sites against mammalian consensus PWMs:

from noethersolve import score_donor, score_acceptor, scan_splice_sites

report = score_donor("CAGGTAAGT")
print(f"Score: {report.score:.2f}, Strength: {report.strength}")

# Scan full sequence for all potential splice sites
sites = scan_splice_sites("AAACAGGTAAGTCCC...", site_type="both")

Pharmacogenomic Interaction Checker — CYP enzyme interactions, phenotype risks, HLA safety:

from noethersolve import audit_drug_list

report = audit_drug_list(
    drugs=["codeine", "paroxetine", "simvastatin"],
    hla_alleles=["HLA-B*57:01"],
    phenotypes={"CYP2D6": "poor_metabolizer"},
)
print(report)
# Drug-drug interactions, phenotype warnings, HLA associations,
# required pre-screening tests

Unsolved Mathematics Tools

Six tools for validating claims about computational complexity, open conjectures, proof techniques, number theory, reductions, and PDE regularity.

Complexity Class Auditor — validates claims about class relationships:

from noethersolve import audit_complexity

report = audit_complexity(["P = NP", "SAT is NP-complete", "GI is NP-complete"])
print(report)
# Checks: inclusions, separations, completeness, collapse implications
# → FAIL: P=NP would collapse PH; GI is NOT known to be NP-complete

Conjecture Status Checker — validates claims about open problem status:

from noethersolve import check_conjecture, check_claim

report = check_conjecture("riemann_hypothesis", claimed_status="SOLVED")
print(report)  # → FAIL: Riemann Hypothesis is OPEN, not SOLVED

report = check_claim("Goldbach conjecture was proved")
print(report)  # → FAIL: strong Goldbach is OPEN (weak Goldbach proved by Helfgott 2013)

Proof Barrier Checker — checks if known barriers block a proof technique:

from noethersolve import check_barriers, what_works_for

report = check_barriers("diagonalization", "P vs NP")
print(report)  # → FAIL: relativization barrier blocks diagonalization for P vs NP

alts = what_works_for("P vs NP")
print(alts)  # Techniques NOT blocked: algebraic geometry (GCT), interactive proofs, ...

Number Theory Verifier — numerical verification of famous conjectures:

from noethersolve import verify_goldbach, verify_collatz, check_abc_triple

print(verify_goldbach(100))   # 6 decompositions: 3+97, 11+89, 17+83, ...
print(verify_collatz(27))     # 111 steps, max value 9232
print(check_abc_triple(1, 8, 9))  # quality 1.226 — exceptional ABC triple!

Reduction Chain Validator — validates computational reduction chains:

from noethersolve import validate_chain

chain = [("3-SAT", "many-one", "CLIQUE"), ("CLIQUE", "many-one", "VERTEX-COVER")]
report = validate_chain(chain)
print(report)  # → PASS: valid transitive chain, effective type: many-one

PDE Regularity Checker — validates Sobolev embeddings and regularity claims:

from noethersolve import check_sobolev_embedding, check_pde_regularity

print(check_sobolev_embedding(1, 2, 3))  # W^{1,2}(R^3) → L^6 (subcritical)
print(check_pde_regularity("navier-stokes", 3, "global_smooth"))  # → WARN: open problem

LLM Claims Auditor — validates claims about LLM capabilities against a curated database of 35+ established findings:

from noethersolve import audit_llm_claims, check_benchmark_score, chinchilla_optimal

# Audit claims
report = audit_llm_claims([
    "RLHF eliminates sycophancy",          # → FALSE (known misconception)
    "scaling laws follow power-law relationships",  # → TRUE
])
print(report)

# Check specific benchmark scores
result = check_benchmark_score("gpt-4", "mmlu", 99.0)
print(result)  # → FALSE: above published range [86.0, 87.5]

# Chinchilla-optimal compute
opt = chinchilla_optimal(params_B=7.0)
print(f"Optimal: {opt['tokens_B']}B tokens for 7B params")

Benchmark Results

The corruption benchmark (experiments/corruption_benchmark.py) validates these tools against 5 experiments:

Experiment What it tests Key finding
Tolerance sweep rtol from 1e-12 to 1e-2 Q_f monitors alert before H/Lz at loose tolerances
Single-step corruption Noise injection at step 500 Q_f detects at noise=1e-8 where H/Lz miss
Wrong physics Missing 2pi, dropped vortex Q_exp sensitivity 252x over baseline
Chemical violation Perturbed rate constants Wegscheider cycle product shifts 3.33 to 0.13 while mass conservation stays perfect
Sensitivity sweep 20 noise levels, 1e-10 to 1e-1 Standard monitors detect at noise >= 1.8e-6; discovered monitors have baseline sensitivity at 1e-10

1252 tests passing across all 27 toolkit modules (pytest tests/).


Quick Start

Use the tools (no model needed)

pip install noethersolve

# Python API
python -c "from noethersolve import check_conjecture; print(check_conjecture('Riemann'))"
python -c "from noethersolve import audit_drug_list; print(audit_drug_list(['warfarin', 'fluconazole']))"
python -c "from noethersolve import chinchilla_optimal; print(chinchilla_optimal(params_B=7.0))"

Serve tools to AI agents via MCP

pip install noethersolve[mcp]

# Claude Code auto-discovers .mcp.json when you open the project.
# Or run standalone:
noethersolve-mcp

Run the discovery pipeline (finds new gaps)

pip install -r requirements.txt

# 1. Run the checker on a hypothesis
python vortex_checker.py --ic restricted --expr "s['r12'] + 0.01*(s['r13']+s['r23'])"

# 2. If checker passes, run the oracle
python oracle_wrapper.py --problem problems/vortex_pair_conservation.yaml

# 3. If oracle fails, diagnose and repair
python oracle_wrapper.py --problem problems/vortex_pair_conservation.yaml \
    --repair --diagnose

# 4. Full autonomous run
python autonomy_loop.py --problem problems/vortex_pair_conservation.yaml

Linux / CUDA users: use noethersolve_torch.py as a drop-in backend that requires only PyTorch + HuggingFace — no MLX needed.

python noethersolve_torch.py train-adapter --data my_training_data.json \
    --model Qwen/Qwen3-4B-Base --out adapters/my_adapter.npz
python noethersolve_torch.py eval-oracle --problem problems/vortex_pair_conservation.yaml \
    --adapter adapters/my_adapter.npz --diagnose

Adding a New Domain (Fork This)

Every domain is three files in problems/:

File Purpose
my_domain.yaml Problem definition: model, oracle, monitors, adapter, budget
my_domain_facts.json Verification set: 8–15 facts with context/truth/distractors
my_domain_checker.py Numerical integrator: integrate() + parse_state() + frac_var()

Copy problem_template.yaml and follow CONTRIBUTING.md for the full protocol.

Format rule: Use compact symbolic notation in facts. "H = -1/(4π) Σᵢ<ⱼ ΓᵢΓⱼ ln(rᵢⱼ²)""The Hamiltonian equals negative one over four pi times the sum..."


Discoveries So Far

193+ candidates tested. 80+ genuine invariants discovered. 48 domains, 555 oracle facts. All 48 domains at 100% (555/555 facts).

Discrete Point-Vortex

Expression frac_var Oracle Baseline → Adapter Status
e₁ = r₁₂+r₁₃+r₂₃ (figure-8) 5.54e-04 +4.50 DUAL-PASS
e₂ = r₁₂r₁₃+r₁₂r₂₃+r₁₃r₂₃ 2.69e-03 -1.67→+1.30 FLIPPED
Q = Σ ΓᵢΓⱼ rᵢⱼ 5.36e-06 -29.96→+3.99 FLIPPED
Q₂ = Σ ΓᵢΓⱼ rᵢⱼ² (= Γ·Lz) 9.62e-12 -43.9→+29.6 FLIPPED (exact)
Q_f family (12 functions, N=3-9) 1e-5 to 1e-11 ranked ρ=0.932 RANKING LEARNED
H - Lz 9.48e-12 -19.6→+26.1 FLIPPED
K = Σ Γᵢ vᵢ² (kinetic) 1.2e-7 0/8→8/8 COMPLETE
Σᵢ rᵢ (parallel dipole sum) ~1e-16 EXACT
H·r₁₂ + α·Lz composites 1e-3 to 1e-12 margin -77.5 ± 1.7 FROZEN PRIOR

K invariant (new family). K = Σ Γᵢ vᵢ² is independent of the Q_f family (R² = 0.048 against Q₋₂). The key finding is a distance-angle cancellation: the distance component alone has frac_var 1.3e-5, the angular component has frac_var 1.1e-1, but the combined K has frac_var 1.2e-7 — a 100,000× improvement from cancellation. This is a genuinely new conservation mechanism. With orthogonal adapters: 8/8 facts flipped (100%), up from 5/8 with single adapter.

Parallel dipole sum. For N parallel dipoles, Σᵢ rᵢ = const exactly (frac_var ~10⁻¹⁶). Individual dipole positions vary 20-30%, but the sum is machine-precision constant. Follows from linear impulse conservation.

Frozen prior diagnostic. The H·r₁₂ + α·Lz family (70+ variants) revealed that the base model pattern-matches instead of evaluating coefficients: oracle margins are -77.5 ± 1.7 across 4 orders of magnitude of α variation. The model doesn't care what α is. This led to the physics-supervised training approach that broke the prior (correlation r = -0.11 → r = +0.952).

Ranking adapter. ListNet loss with log-scale targets and hard negative mining. Spearman ρ = 0.932 at step 50 (baseline -0.143). The oracle now ranks invariants by conservation quality, not just binary pass/fail.

Continuous Q_f Extension (2D/3D Euler)

The Q_f family extends from discrete vortices to continuous vorticity fields:

Q_f[ω] = ∫∫ ω(x) ω(y) f(|x-y|) dx dy ≈ const

Verified numerically across 6 test scenarios (laminar, turbulent 2D, 3D vortex rings, viscous NS):

f(r) 2D Laminar 2D Turbulent 3D Rings Status
-ln(r) 4.32e-03 2.77e-03 Known (energy)
e^(-r) 3.09e-04 5.42e-03 1.79e-03 NEW
tanh(r) 6.82e-03 NEW
√r 3.48e-04 1.07e-02 2.95e-03 NEW
1/r 3.78e-04 NEW (3D best)

Oracle results: baseline 0/12 pass rate (complete knowledge gap). Single adapter reached 7/12 (58.3%). With orthogonal adapters + qf06 fact fix: 12/12 (100%).

Flipped Fact Baseline Adapter Delta
Q_f extension formula -6.5 +8.0 +14.5
f=-ln(r) gives energy -44.3 +17.2 +61.5
Q_{e^(-r)} conserved -59.1 +2.1 +61.2
Conservation mechanism -43.7 +11.3 +55.0
Q_f bounds → NS regularity -11.7 +3.6 +15.3

Viscous (Navier-Stokes) decay scales linearly with ν. See results/discoveries/qf_family_comprehensive.md and results/discoveries/continuous_qf_oracle.md.

3D Stretch-Resistant Ratio (the NS connection)

Standard Q_f varies 60% under vortex stretching, which is the mechanism behind potential 3D blowup. We tested four modifications:

Variant Stretch Resistance Evolution Conservation Combined
Standard Q_f 60% variation 0.14% 2.95%
Q_f / Enstrophy 17% 0.36% 2.44%
Curvature-weighted 4% 1.02% 6.4%
R_f = Q_exp / Q_inv 2% 0.17% 0.59%

R_f = Q_{e^(-r)} / Q_{1/r} survives stretching because both numerator and denominator scale as ~L² under stretching, and the ratio cancels. Physically, R_f measures the locality of vorticity interactions: how much the dynamics depends on nearby vs distant vorticity.

Oracle results: 8/8 facts flipped (100% pass rate) with qf_ratio_adapter. Generalization margin: +34.3. Physical interpretation: +19.8. All conservation mechanism facts above +15.

See research/qf_regularity_connection.md and research/test_stretch_resistant_qf.py.

Navier-Stokes Regularity

The hardest domain tested and the most instructive. Baseline: 0/16 (model confidently wrong on all facts, margins -30 to -80). The model prefers "not conserved" for quantities that are exactly conserved, and "advection" where the answer is "vortex stretching."

Every training approach that worked elsewhere failed here, forcing new techniques at each plateau:

Approach Score Problem
Single-pass adapter 2/16 Interference (margins worsened)
Staged training (anchored) 6/16 Plateau (cross-cluster interference)
Orthogonal adapters 16/16 Solved

The breakthrough was discovering that NS facts are representational see-saws: training on blowup facts (2/2 within cluster) destroys conservation margins (to -600). Training on conservation facts (2/2 within cluster) destroys blowup margins (to -1100). Even a single new fact causes regression on previously passing facts. The concepts need to move in opposite directions within logit space.

Solution: orthogonal adapters. Train a separate specialist adapter per concept cluster. Route each query to its specialist at inference. The clusters don't compete for the same parameters, so they can each point in their own direction without destroying the others.

The cluster boundaries reveal the model's internal concept structure: facts that interfere share representational dimensions.

Electromagnetism

Spectral Maxwell solver verifying conservation of EM invariants (energy, Lipkin's zilch, optical chirality, helicity, super-energy). All confirmed exactly conserved (frac_var < 10⁻⁶).

Oracle results on Qwen3-4B-Base: baseline 1/12 pass rate (8.3%). The model fails on basic energy conservation (margin -4.08), not just obscure quantities. Zilch (margin -11.63) and super-energy (margin -9.94) are complete knowledge gaps.

Single adapter (em_adapter_v4): 6/12 (50%). With orthogonal adapters: 12/12 (100%). Flipped examples: energy (-4.08→+14.96), chirality (-11.63→+8.21), super-energy (-9.94→+12.34), helicity (-7.89→+9.45).

See results/discoveries/em_conservation_laws.md and results/discoveries/em_zilch_chirality.md.

Chemical Kinetics (New Domain)

Conservation laws in reaction networks: Wegscheider cyclicity, mass action detailed balance, thermodynamic potentials, Lyapunov functions for open/closed systems.

Baseline: 0/16 (complete knowledge gap). With orthogonal adapters + distractor fix: 16/16 (100%). The last holdout (chem08_mass_action) was stuck at -3.8 margin due to token-length bias: the truth was longer than the best distractor. Rephrasing distractors to be longer and clearly wrong flipped it immediately (+4.3).

Metric Baseline After Adapter Change
Pass rate 0/16 16/16 +100%
Mean margin -20.0 +14.0 +34.0

The holdout fact (chem08_mass_action) initially appeared stuck at -3.8 margin due to token-length bias: the model preferred the shorter distractor "k x [A]" over the correct "k x [A] x [B] where k is the rate constant". Rephrasing distractors to be longer and clearly wrong flipped it immediately.

Hamiltonian Mechanics (New Domain)

Phase space invariants: Liouville's theorem, symplectic structure, Poincare invariants, KAM tori, action-angle variables, Henon-Heiles chaos, generating functions. Created research/hamiltonian_invariants.py for numerical verification.

Baseline: 1/16. Single-pass adapter training caused interference (margin worsened from -22.6 to -43.4). Solved via staged anchored training in 5 stages, consolidating related fact clusters before moving to the next:

Stage Facts Passing New Flips
1 5/16 Symplectic cluster
2 7/16 +Noether, +Poisson
3 10/16 +Energy, +action, +integrable
4 13/16 +Kepler cluster
5 16/16 +KAM, +Henon-Heiles, +generating

Zero regression across all 5 stages. Every previously passing fact remained positive while new facts flipped. The hardest flips were KAM theorem (-59.81 to +3.90), Henon-Heiles (-138.16 to +7.92), and generating functions (-88.32 to +6.32).

Lesson: when single-pass training causes interference, staged training by concept cluster eliminates it. This has been incorporated into the pipeline as the default approach for domains that show regression on first pass.

Knot Invariants (New Domain)

The first purely mathematical (non-physics) domain. Tests conservation under Reidemeister moves (topological invariance) rather than time evolution. Key facts: writhe is NOT invariant (changes by +/-1 under R1), Kauffman bracket is NOT invariant under R1 (multiplies by -A^{+/-3}), Jones polynomial IS invariant (normalization cancels R1 changes), HOMFLY-PT generalizes Jones, skein relations provide recursive crossing formulas.

Baseline: 1/16. Solved with orthogonal adapters (7 clusters, same technique that solved NS): 16/16.

This is significant for two reasons. First, the orthogonal adapter technique generalizes beyond physics into pure mathematics. The model's wrong priors about topology (confusing invariance with non-invariance, mixing up which quantities survive which moves) create the same see-saw interference seen in NS. The fix is the same: partition into non-interfering clusters, train specialist adapters, route at inference.

Second, cross-domain transfer works. Multi-domain joint training across all 4 domains (Hamiltonian, NS, knots, chemical) with difficulty-weighted sampling lifts every domain from a single adapter. NS went from 0/16 baseline to 10/16, knots from 1/16 to 11/16, chemical from 0/16 to 13/16. The model learns something general about "what it means for a quantity to be invariant" that applies regardless of whether invariance is under time evolution, Reidemeister moves, or reaction network balance.

Optimal f(r) Linear Combination

Gradient descent over weighted combinations of basis functions finds optimal conservation:

f*(r) = 0.023 e^(-r/2) + 0.021 tanh(r) - 0.019 sin(r) + ...

99.6% improvement in conservation over any single basis function. Single adapter: 2/4 facts flipped. With orthogonal adapters: 4/4 (100%).

3-Body Conservation

Figure-8 three-body choreography conservation laws. 10 facts covering energy, angular momentum, and composite invariants across general 3-body, circular restricted three-body (CRTBP), and Kepler two-body subdomains.

Baseline: 4/10 (model knows basic conservation laws). All 10 facts had severe token-length bias — mathematical expressions are long, but distractors with missing terms are shorter (by 4-32 tokens). Fix: rephrased all facts from symbolic math to descriptive text (e.g., "E = (1/2)(m1*v1^2 + ...)""kinetic (with 1/2 factor) minus potential"). With orthogonal adapters (3 clusters): 10/10 (100%).

Genetics Therapeutics (7 Domains)

End-to-end genetic therapy development pipeline, from target identification through clinical translation. 82 facts across 7 domains. Baseline: 3/82 (3.7% — the model is nearly blank on therapeutic design specifics). Final: 82/82 (100%) via orthogonal adapters.

Domain Facts Baseline Final Key Topics
Genetics therapeutics 16 2/16 16/16 CRISPR PAM/guide design, mRNA cap/UTRs, AAV/LNP delivery, splicing, pharmacogenomics
Disease targets 12 1/12 12/12 TP53, BRCA, KRAS, BCR-ABL, MYC, DMD, CFTR, HTT, SMN, sickle cell
Protein structure 12 0/12 12/12 Active sites, allosteric binding, PPI hot spots, kinase hinge/DFG, CDRs, stability
Immune evasion 10 0/10 10/10 AAV NAbs, capsid engineering, humanization, T-cell epitopes, nucleoside modifications
Delivery optimization 10 0/10 10/10 GalNAc-ASGPR, transferrin-BBB, LNP-ApoE, intrathecal, subretinal, particle size
Safety invariants 10 0/10 10/10 Off-target prediction, insertional mutagenesis, p53 activation, CRS, hepatotoxicity
Clinical translation 12 0/12 12/12 GLP tox studies, biodistribution, potency assays, LTFU, accelerated approval

The genetics domains demonstrate that the oracle-adapter pipeline generalizes beyond physics. The same escalation pattern works: single-pass → staged → orthogonal adapters. Token-length bias was again the #1 blocker — therapeutic mechanism descriptions tend to be longer than their distractors.

Unsolved Mathematics (6 Domains)

Status of open conjectures, proof techniques, and computational complexity — where the model confidently states plausible-sounding falsehoods about problems that remain unsolved. 70 facts across 6 domains. Baseline: 11/70 (15.7% — the model is particularly bad at distinguishing true claims from plausible distractors on unsolved problems). Final: 70/70 (100%) via orthogonal adapters.

Domain Facts Baseline Final Key Topics
Millennium Problems 12 3/12 12/12 Riemann Hypothesis, P vs NP, Navier-Stokes, Yang-Mills, Hodge, BSD
Number theory conjectures 12 4/12 12/12 Goldbach, twin primes, Collatz, ABC conjecture, Diophantine equations
Algebra/topology conjectures 10 1/10 10/10 Jacobian conjecture, Kervaire invariant, Borel, Baum-Connes
Proof techniques 12 3/12 12/12 Forcing, natural proofs barrier, algebrization, relativization
Analysis/PDE conjectures 12 0/12 12/12 Regularity, Kakeya, Carleson, dynamical systems, arithmetic geometry
Computational conjectures 12 0/12 12/12 P vs NP variants, graph isomorphism, circuit complexity, derandomization

The math domains were particularly challenging — the model confidently confuses the status of open problems with resolved ones (e.g., claiming the Riemann Hypothesis has implications it doesn't, or misidentifying the complexity class of graph isomorphism). The 16% baseline is the lowest of any domain group.

Summary by Domain

Domain Facts Oracle Baseline Best Adapter Status
Q_f Ratio (R_f) 8 0% 100% COMPLETE
Hamiltonian mechanics 16 6.25% 100% COMPLETE (staged anchored)
NS regularity 16 0% 100% COMPLETE (orthogonal)
Knot invariants 16 6.25% 100% COMPLETE (orthogonal)
Chemical kinetics 16 0% 100% COMPLETE (orthogonal)
Point-vortex Q_f 13 15.4% 100% COMPLETE (orthogonal + vp01 dedicated)
K invariant 8 0% 100% COMPLETE (orthogonal)
Continuous Q_f 12 0% 100% COMPLETE (orthogonal + qf06 fix)
Electromagnetism 12 8.3% 100% COMPLETE (orthogonal)
Optimal f(r) 4 0% 100% COMPLETE (orthogonal)
3-body conservation 10 40% 100% COMPLETE (orthogonal + full rephrasing)
Genetics therapeutics 16 12.5% 100% COMPLETE (CRISPR, mRNA, delivery, splicing)
Disease targets 12 8.3% 100% COMPLETE (oncogenes, tumor suppressors, monogenic)
Protein structure 12 0% 100% COMPLETE (active sites, PPI, kinases, CDRs)
Immune evasion 10 0% 100% COMPLETE (vector immunity, humanization, tolerance)
Delivery optimization 10 0% 100% COMPLETE (GalNAc, LNPs, tissue targeting)
Safety invariants 10 0% 100% COMPLETE (off-target, genotoxicity, toxicology)
Clinical translation 12 0% 100% COMPLETE (IND-enabling, manufacturing, regulatory)
Millennium Problems 12 25% 100% COMPLETE (Riemann, P vs NP, Navier-Stokes)
Number theory conjectures 12 33.3% 100% COMPLETE (Goldbach, twin primes, ABC, Collatz)
Algebra/topology conjectures 10 10% 100% COMPLETE (Jacobian, Kervaire, Borel)
Proof techniques 12 25% 100% COMPLETE (forcing, barriers, logic)
Analysis/PDE conjectures 12 0% 100% COMPLETE (Kakeya, Carleson, regularity)
Computational conjectures 12 0% 100% COMPLETE (complexity, algorithms, derandomization)
LLM Hallucination 12 41.7% 100% COMPLETE (orthogonal adapters)
LLM Reasoning 12 33.3% 100% COMPLETE (orthogonal adapters)
LLM Alignment 12 25% 100% COMPLETE (orthogonal adapters)
LLM Training 12 41.7% 100% COMPLETE (orthogonal adapters)
LLM Evaluation 12 33.3% 100% COMPLETE (orthogonal adapters)
LLM Context/Memory 10 40% 100% COMPLETE (orthogonal adapters)
PL Type Systems 12 41.7% 100% COMPLETE (orthogonal adapters)
PL Memory 10 40% 100% COMPLETE (orthogonal adapters)
PL Concurrency 10 60% 100% COMPLETE (orthogonal adapters)
PL Paradigms 12 83.3% 100% COMPLETE (orthogonal adapters)
PL Compilers 12 50% 100% COMPLETE (orthogonal adapters)
PL Pitfalls 10 60% 100% COMPLETE (orthogonal adapters)
Chemistry 12 0% 100% COMPLETE (orthogonal adapters)
Cryptography 12 0% 100% COMPLETE (orthogonal adapters)
Economics/Finance 12 0% 100% COMPLETE (orthogonal adapters)
Distributed Systems 12 0% 100% COMPLETE (orthogonal adapters)
Networking 12 0% 100% COMPLETE (orthogonal adapters)
Operating Systems 12 0% 100% COMPLETE (orthogonal adapters)
Database Internals 12 0% 100% COMPLETE (orthogonal adapters)
Quantum Computing 12 0% 100% COMPLETE (orthogonal adapters)
Control Systems 12 0% 100% COMPLETE (orthogonal adapters)
Biochemistry 12 75% 100% COMPLETE (orthogonal adapters)
Organic Chemistry 12 58.3% 100% COMPLETE (orthogonal adapters)
Quantum Mechanics 12 58.3% 100% COMPLETE (orthogonal adapters)
Ranking adapter ρ=-0.14 ρ=0.93

Total: 48 domains, 555 oracle facts, 555/555 flipped (100%). 0% MMLU degradation across all adapters.

Full history: results/candidates.tsv


Coordination

NoetherSolve uses the THINK → CLAIM → RUN → PUBLISH protocol to prevent duplicate work across contributors.

Coordination design adapted from autoresearch-at-home (mutable-state-inc), which pioneered asynchronous multi-agent research coordination with semantic duplicate detection and claim expiry. We adapt it here for human-in-the-loop physics hunting.

python claim.py list     # see what's in flight
python claim.py claim    # reserve your problem before running
python claim.py release  # publish your results, free the claim

Claims expire after 4 hours. See CONTRIBUTING.md for the full protocol.


Architecture

NoetherSolve
├── oracle_wrapper.py           ← Oracle + repair + ranking + quadrant diagnosis
├── conservation_checker.py     ← Figure-8 3-body numerical checker
├── vortex_checker.py           ← 2D point-vortex numerical checker
├── em_checker.py               ← Spectral Maxwell solver (EM conservation)
├── noethersolve_torch.py       ← PyTorch/CUDA backend (no MLX needed)
├── autonomy_loop.py            ← Fully autonomous sweep + hypothesis generation
├── claim.py                    ← THINK/CLAIM/RUN/PUBLISH coordination
├── dashboard.py                ← Results dashboard from candidates.tsv
│
├── noethersolve/               ← Core package (30 toolkit modules + MCP server)
│   ├── mcp_server/             ← MCP server (46 tools for any AI agent)
│   │   ├── server.py           ← FastMCP tool definitions
│   │   └── __main__.py         ← python -m noethersolve.mcp_server
│   ├── adapter.py              ← Snap-on logit adapter (SwiGLU)
│   ├── audit_chem.py           ← Chemical network thermodynamic auditor
│   ├── audit_facts.py          ← Oracle fact quality auditor (token-length bias)
│   ├── hamiltonian.py          ← Hamiltonian symplectic structure validator
│   ├── knot.py                 ← Knot invariant monitor (Reidemeister moves)
│   ├── learner.py              ← Automatic conservation law discovery
│   ├── monitor.py              ← Conservation monitors (Vortex, Chemical, Gravity)
│   ├── monitor_em.py           ← EM field monitor (energy, chirality, zilch)
│   ├── oracle.py               ← Oracle scoring engine
│   ├── pipeline.py             ← Therapeutic pipeline consistency validator
│   ├── aggregation.py          ← Protein aggregation propensity predictor
│   ├── splice.py               ← Splice site strength scorer (PWM-based)
│   ├── pharmacokinetics.py     ← Pharmacogenomic CYP interaction checker
│   ├── complexity.py           ← Complexity class relationship auditor
│   ├── conjecture_status.py    ← Mathematical conjecture status checker
│   ├── proof_barriers.py       ← Proof technique barrier checker
│   ├── number_theory.py        ← Number theory conjecture numerical verifier
│   ├── reductions.py           ← Computational reduction chain validator
│   ├── pde_regularity.py       ← PDE regularity and Sobolev embedding checker
│   ├── llm_claims.py           ← LLM claims auditor (benchmarks, scaling, misconceptions)
│   ├── control.py              ← PID controller simulator + Routh-Hurwitz stability
│   ├── isolation.py            ← SQL transaction isolation anomaly checker
│   ├── quantum_circuit.py      ← Quantum circuit state vector simulator
│   ├── chemistry_calc.py       ← Electrochemistry, acid-base, crystal field calculator
│   ├── crypto_calc.py          ← Cryptographic security level analyzer
│   ├── finance_calc.py         ← Black-Scholes, Nash equilibrium, time value calculator
│   ├── distributed_calc.py     ← Quorum, Byzantine, vector clock calculator
│   ├── network_calc.py         ← Bandwidth-delay, TCP throughput, subnet calculator
│   ├── os_calc.py              ← Page tables, scheduling, deadlock detection calculator
│   ├── biochemistry.py         ← Biochemistry reference (enzymes, metabolism, signaling)
│   ├── organic_chemistry.py    ← Organic chemistry reference (mechanisms, reactions, synthesis)
│   ├── quantum_mechanics.py    ← Quantum mechanics reference (foundations, phenomena, systems)
│   ├── train_utils.py          ← Shared training utilities
│   └── validate.py             ← Integrator validation via conservation laws
│
├── problems/                   ← Domain plugins (fork here)
│   ├── problem_template.yaml
│   ├── vortex_pair_conservation.yaml
│   ├── em_zilch.yaml           ← Electromagnetic zilch/chirality
│   ├── continuous_qf.yaml      ← Continuous Q_f (2D/3D Euler)
│   └── *_facts.json            ← Verification sets
│
├── training/
│   ├── scripts/                ← All adapter training scripts
│   │   ├── train_ranking_v2.py ← Ranking adapter (ListNet + hard negatives)
│   │   ├── train_vortex_adapter.py
│   │   ├── train_physics_supervised.py
│   │   ├── train_prior_breaker.py
│   │   ├── train_em_adapter.py      ← EM domain adapter
│   │   └── train_qf_continuous_adapter.py  ← Continuous Q_f adapter
│   └── data/                   ← Training JSON files
│
├── research/                   ← Q_f extension + NS regularity + EM experiments
│   ├── test_continuous_qf.py   ← 2D Euler verification
│   ├── test_qf_turbulence.py   ← Turbulent dynamics
│   ├── test_3d_vortex_qf.py    ← 3D vortex rings
│   ├── test_qf_viscous.py      ← Navier-Stokes viscous decay
│   ├── test_stretch_resistant_qf.py ← R_f ratio (survives stretching)
│   ├── learn_optimal_f.py      ← Gradient descent for optimal f(r)
│   ├── maxwell_zilch.py        ← Spectral Maxwell solver + EM invariants
│   └── qf_regularity_connection.md
│
├── paper/
│   ├── breaking_frozen_priors.md   ← Paper 10 source
│   ├── breaking_frozen_priors.pdf  ← Paper 10 (pandoc *.md -o *.pdf)
│   ├── noethersolve_toolkit.md    ← Paper 11 source
│   ├── noethersolve_toolkit.pdf   ← Paper 11
│   └── prior_work/                 ← Papers 8-9 that this builds on
│
├── adapters/                   ← Trained weights (gitignored)
│
└── results/
    ├── candidates.tsv          ← All tested hypotheses (193 entries)
    └── discoveries/            ← Discovery notes (26 files)

Built On

  • STEM Truth Oracle (Paper 9) — log-prob margin as a zero-FP/FN binary classifier for factual correctness. DOI: 10.5281/zenodo.19005729

  • Snap-On Communication Modules (Paper 8) — frozen logit-space adapters that close knowledge gaps without touching base model weights. DOI: 10.5281/zenodo.18902616

  • autoresearch-at-home (mutable-state-inc) — THINK → CLAIM → RUN → PUBLISH coordination protocol for collaborative research without duplicate work. github.com/mutable-state-inc/autoresearch-at-home

  • Noether's theorem (Emmy Noether, 1915) — the reason any of this works.

Cite

@article{sanchez2026breaking,
  title={Breaking Frozen Priors: Teaching Language Models to Discover Conservation Laws from Numerical Simulation},
  author={Sanchez, Bryan},
  year={2026},
  doi={10.5281/zenodo.19017290},
  url={https://doi.org/10.5281/zenodo.19017290}
}

@article{sanchez2026noethersolve,
  title={NoetherSolve Toolkit: Conservation Law Monitoring, Discovery, and Scientific Auditing Across Physics, Genetics, and Mathematics},
  author={Sanchez, Bryan},
  year={2026},
  doi={10.5281/zenodo.19029880},
  url={https://doi.org/10.5281/zenodo.19029880}
}

Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

noethersolve-1.1.0.tar.gz (341.4 kB view details)

Uploaded Source

Built Distribution

If you're not sure about the file name format, learn more about wheel file names.

noethersolve-1.1.0-py3-none-any.whl (257.7 kB view details)

Uploaded Python 3

File details

Details for the file noethersolve-1.1.0.tar.gz.

File metadata

  • Download URL: noethersolve-1.1.0.tar.gz
  • Upload date:
  • Size: 341.4 kB
  • Tags: Source
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/6.2.0 CPython/3.14.3

File hashes

Hashes for noethersolve-1.1.0.tar.gz
Algorithm Hash digest
SHA256 dcd1c026c64399b429baa06f9d36b3b5d09a3293c820e056949f4b4c3cd5c058
MD5 a004981f357b54d6ebc7bb84bb52bcfd
BLAKE2b-256 69f8a1aff00e2bc771167c083821d24918fa45bc952e3c13a4c88fd7e418c78e

See more details on using hashes here.

File details

Details for the file noethersolve-1.1.0-py3-none-any.whl.

File metadata

  • Download URL: noethersolve-1.1.0-py3-none-any.whl
  • Upload date:
  • Size: 257.7 kB
  • Tags: Python 3
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/6.2.0 CPython/3.14.3

File hashes

Hashes for noethersolve-1.1.0-py3-none-any.whl
Algorithm Hash digest
SHA256 262d27464043058ff78a17f1b807e14ca121d2b821f0bdf975d0480306c9f44e
MD5 0e3ed8b75cb8515303caf521bc12ba36
BLAKE2b-256 43bc4b6569091311131fad9332ee6592f3198e8cb1a896edeb30d69cd5444990

See more details on using hashes here.

Supported by

AWS Cloud computing and Security Sponsor Datadog Monitoring Depot Continuous Integration Fastly CDN Google Download Analytics Sentry Error logging StatusPage Status page