Draw nucleic acid structures
Project description
NucDraw is a simple Python package inspired by Forgi for the creation of NUCleic acid structures DRAWings. It relies on viennaRNA and matplotlib to convert 1D dot-bracket structures into easily to interpret 2D drawings.
This package is well-suited to generate many structures in an automated way from multiplexed and high-throughput data, and allows to visualize multiple strands without pseudo-knots.
To install simply run from terminal: pip install git+https://github.com/mtod92/nucdraw
Several functionalities are included to allow the customization of your graphs. See the following examples.
If you use this package for your project, please remember to cite: 10.5281/zenodo.15351036
from nucdraw import NucDraw
# Let's generate a simple-to-read graph for a long RNA fold
seq = "CACAAUGUGGCCGAGGACUUUGAUUGCACAUUGUUGUUUUUUUAAUAGUCAUUCCAAAUAUGAGAUGCGUUGUUACAGGAAGUCCCUUGCCAUCCUAAAAGCCACCCCACUUCUCUCUAAGGAGAAUGGCCCAGUCCUCUCCCAAGUCCACACAGGGGAGGUGAUAGCAUUGCUUUCGUGUAAAUUAUGUAAUGCAAAAUUUUUUUAAUCUUCGCCUUAAUACUUUUUUAUUUUGUUUUAUUUUGAAUGAUGAGCCUUCGUGCCCCCCCUUCCCCCUUUUUUGUCCCCCAACUUGAGAUG"
mfe = ".((((((((....((....)).....)))))))).......................................((((..(((............................((((((....))))))...........((((((............))))))............)))..))))......................................................................................................................"
nc = NucDraw(mfe)
nc.generate(degree=90)
nc.plotter(8, bckwargs={'lw':2, 'color':'k'}, bpkwargs={'lw':2, 'c':'red'}, scwargs={'s':10, 'c':'k'})
# Let's focus on one section and increase the details
seq = "CACAAUGUGGCCGAGGACUUUGAUUGCACAUUGUUGUUUUUUUAAUAGUCAUUCCAAAUAUGAGAUGCGUUGUUACAGGAAGUCCCUUGCCAUCCUAAAAGCCACCCCACUUCUCUCUAAGGAGAAUGGCCCAGUCCUCUCCCAAGUCCACACAGGGGAGGUGAUAGCAUUGCUUUCGUGUAAAUUAUGUAAUGCAAAAUUUUUUUAAUCUUCGCCUUAAUACUUUUUUAUUUUGUUUUAUUUUGAAUGAUGAGCCUUCGUGCCCCCCCUUCCCCCUUUUUUGUCCCCCAACUUGAGAUG"
mfe = ".((((((((....((....)).....)))))))).......................................((((..(((............................((((((....))))))...........((((((............))))))............)))..))))......................................................................................................................"
seq = seq[:50]
mfe = mfe[:50]
nc = NucDraw(mfe)
nc.generate(degree=90)
nc.plotter(8, bckwargs={'lw':2, 'color':'k'}, bpkwargs={'lw':2, 'c':'red'}, scwargs={'s':10, 'c':'k'})
nc.plot_circles(circle_size = 4, circle_color='white')
nc.plot_sequence(seq, {'fontsize':8, 'color':'k'})
# Let's focus on one section and increase the details
# Let's color-code the nucleobases
seq = "CACAAUGUGGCCGAGGACUUUGAUUGCACAUUGUUGUUUUUUUAAUAGUCAUUCCAAAUAUGAGAUGCGUUGUUACAGGAAGUCCCUUGCCAUCCUAAAAGCCACCCCACUUCUCUCUAAGGAGAAUGGCCCAGUCCUCUCCCAAGUCCACACAGGGGAGGUGAUAGCAUUGCUUUCGUGUAAAUUAUGUAAUGCAAAAUUUUUUUAAUCUUCGCCUUAAUACUUUUUUAUUUUGUUUUAUUUUGAAUGAUGAGCCUUCGUGCCCCCCCUUCCCCCUUUUUUGUCCCCCAACUUGAGAUG"
mfe = ".((((((((....((....)).....)))))))).......................................((((..(((............................((((((....))))))...........((((((............))))))............)))..))))......................................................................................................................"
seq = seq[:50]
mfe = mfe[:50]
nc = NucDraw(mfe)
nc.generate(degree=90)
nc.plotter(8, bckwargs={'lw':2, 'color':'k'}, bpkwargs={'lw':2, 'c':'k'}, scwargs={'s':10, 'c':'k'})
nc.plot_circles(seq, circle_size = 4)
nc.plot_sequence(seq, {'fontsize':8, 'color':'k'})
# Let's draw a 2-strands complex
seq1 = 'UGACGUAAAACUGAC'
seq2 = 'UGUUACCGUA'
seq = "".join([seq1, seq2])
mfe = '..((((..(((....+.))))).)).'
nc = NucDraw(mfe)
nc.generate()
nc.plotter(6, bckwargs={'lw':2, 'color':'k'}, bpkwargs={'lw':3, 'c':'k'}, scwargs={'s':10, 'c':'k'})
nc.plot_circles(seq, circle_size = 3, circle_color='white')
# Let's draw a 3-strands complex and color the strands differently
seq1 = 'UGACGUAAAACUGAC'
seq2 = 'UGUUACCGUAGUACG'
seq3 = 'ACCGUAC'
seq = "".join([seq1, seq2, seq3])
mfe = '..((((..(((....+.))))).)).(((((+..)))))'
nc = NucDraw(mfe)
nc.generate()
nc.plotter(8, bckwargs={'lw':2, 'color':'k'}, bpkwargs={'lw':3, 'c':'k'}, scwargs={'s':10, 'c':'k'})
nc.plot_circles(seq, circle_size = 2, circle_color='white')
nc.multistrand_coloring(clr=['red', 'blue', 'green'], bckwargs={'lw' : 3})
Project details
Release history Release notifications | RSS feed
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
Built Distribution
Filter files by name, interpreter, ABI, and platform.
If you're not sure about the file name format, learn more about wheel file names.
Copy a direct link to the current filters
File details
Details for the file nucdraw-0.1.1.tar.gz.
File metadata
- Download URL: nucdraw-0.1.1.tar.gz
- Upload date:
- Size: 5.3 kB
- Tags: Source
- Uploaded using Trusted Publishing? No
- Uploaded via: twine/6.1.0 CPython/3.10.16
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
6146b15283abe21df12002a05f17c07b244b4b9d0372bfe963cccce0106356df
|
|
| MD5 |
d6562cd4a4a763cff5a3e22fe2a28d58
|
|
| BLAKE2b-256 |
9c0c6cf66e1204e11f941086a3eb469bcbffe5b2062c1c165b4254bfb0a5b769
|
File details
Details for the file nucdraw-0.1.1-py3-none-any.whl.
File metadata
- Download URL: nucdraw-0.1.1-py3-none-any.whl
- Upload date:
- Size: 5.7 kB
- Tags: Python 3
- Uploaded using Trusted Publishing? No
- Uploaded via: twine/6.1.0 CPython/3.10.16
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
7186ed5c859609c77f08e86a6dca47206504d18532952ffa88494c212ceecfb7
|
|
| MD5 |
0d22061d444758e0928552b62abea404
|
|
| BLAKE2b-256 |
fb8f80da1263845078696698e35d665f8ecbf5a1aee4217063aac972454e6476
|