OSTIR (Open Source Translation Initiation Rates)
OSTIR is a
Python package for predicting the rates at which ribosomes will bind to and initiate
translation from different start codons in bacterial mRNAs. It uses the ViennaRNA Package to perform
the necessary free energy calculations. The code builds on the last open source version of the
RBS calculator.
OSTIR includes several improvements in usability. It supports multi-FASTA
input with command line parameters or CSV input that can define
parameters on a per-sequence basis. Additionally, OSTIR supports multi-threaded
execution, accelerating the analysis of very large sequences.
Please see the OSTIR Wiki for full documentation
Quickstart
Installation
Step by step
OSTIR is a Python module and associated command line script. We recommend installing OSTIR using Bioconda on Linux or macOS. This will automatically install OSTIR and all of its dependencies, including ViennaRNA and the required Python modules.
From Bioconda (recommended; Linux, macOS):
- Run
conda install -c bioconda ostir
From Pip (for experts; Linux, macOS, Windows):
- Download and install ViennaRNA, following the instructions here.
- Run
pip install ostir
For information on installing for development see the Wiki Documentation.
Docker
For an express run and assuming there is Docker in your system you may:
docker build . -t ostir:latest
docker run -it ostir
You should see ostir -h output
Note: By default Dockerfile is linked to Dockerfile.miniforge so that miniforge is being used to install conda. If you want any other installer (Miniconda or Anaconda), please rename/link at your best convenience.
Command Line Usage
Print OSTIR help:
ostir -h
Run OSTIR on a sequence provided at the command line and print output to the console:
ostir -i TTCTAGATGAGAATAAGGTTATGGCGAGCTCTGAAGACGTTATCAAAGAGTTCATGCGTTTCAAAGTTCGTATGGAAGGT
Run OSTIR on all sequences provided in a FASTA file and print output to a CSV file:
ostir -i input.fasta -o output.csv
More options and examples are described in the Wiki Documentation.
Python Module Usage
Run OSTIR on a sequence inside of a Python script:
from ostir import run_ostir
seq = "ACUUCUAAUUUAUUCUAUUUAUUCGCGGAUAUGCAUAGGAGUGCUUCGAUGUCAU"
results = run_ostir(seq, name="my_sequence", threads=8)
print(results)
More options and examples are described in the Wiki Documentation.
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
Built Distribution
Filter files by name, interpreter, ABI, and platform.
If you're not sure about the file name format, learn more about wheel file names.
Copy a direct link to the current filters
File details
Details for the file ostir-1.1.3.tar.gz.
File metadata
- Download URL: ostir-1.1.3.tar.gz
- Upload date:
- Size: 165.2 kB
- Tags: Source
- Uploaded using Trusted Publishing? Yes
- Uploaded via:
twine/5.1.1 CPython/3.12.7
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
6fa38a4e867c8d38aab16b59addc07ce2de03ee766ef6018c24c7a78ff163e14
|
|
| MD5 |
f908ca01117d2b3822f57f8e36a9553d
|
|
| BLAKE2b-256 |
abf76e62f0f43ff828da0f24696bc70b34f9ea2d6b70490d2e2a4fadaf168213
|
Provenance
The following attestation bundles were made for ostir-1.1.3.tar.gz:
Publisher:
publish-to-pypi.yml on barricklab/ostir
-
Statement:
-
Statement type:
https://in-toto.io/Statement/v1 -
Predicate type:
https://docs.pypi.org/attestations/publish/v1 -
Subject name:
ostir-1.1.3.tar.gz -
Subject digest:
6fa38a4e867c8d38aab16b59addc07ce2de03ee766ef6018c24c7a78ff163e14 - Sigstore transparency entry: 150547381
- Sigstore integration time:
-
Permalink:
barricklab/ostir@9a1a5744bd70f28313a342ba9bf7946c8cd12bd2 -
Branch / Tag:
refs/heads/master - Owner: https://github.com/barricklab
-
Access:
public
-
Token Issuer:
https://token.actions.githubusercontent.com -
Runner Environment:
github-hosted -
Publication workflow:
publish-to-pypi.yml@9a1a5744bd70f28313a342ba9bf7946c8cd12bd2 -
Trigger Event:
workflow_dispatch
-
Statement type:
File details
Details for the file OSTIR-1.1.3-py3-none-any.whl.
File metadata
- Download URL: OSTIR-1.1.3-py3-none-any.whl
- Upload date:
- Size: 106.2 kB
- Tags: Python 3
- Uploaded using Trusted Publishing? Yes
- Uploaded via:
twine/5.1.1 CPython/3.12.7
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
13f94950a2316ff83f06f0830477e2d4ebd240bc1941453716a5db8055a6ce2f
|
|
| MD5 |
357ac1b47337ef3fb9fe92d4853de624
|
|
| BLAKE2b-256 |
8b2a225597f7fe6ee1b446cdd6362e8b23c547c28a760e024099fefdaad52728
|
Provenance
The following attestation bundles were made for OSTIR-1.1.3-py3-none-any.whl:
Publisher:
publish-to-pypi.yml on barricklab/ostir
-
Statement:
-
Statement type:
https://in-toto.io/Statement/v1 -
Predicate type:
https://docs.pypi.org/attestations/publish/v1 -
Subject name:
ostir-1.1.3-py3-none-any.whl -
Subject digest:
13f94950a2316ff83f06f0830477e2d4ebd240bc1941453716a5db8055a6ce2f - Sigstore transparency entry: 150547383
- Sigstore integration time:
-
Permalink:
barricklab/ostir@9a1a5744bd70f28313a342ba9bf7946c8cd12bd2 -
Branch / Tag:
refs/heads/master - Owner: https://github.com/barricklab
-
Access:
public
-
Token Issuer:
https://token.actions.githubusercontent.com -
Runner Environment:
github-hosted -
Publication workflow:
publish-to-pypi.yml@9a1a5744bd70f28313a342ba9bf7946c8cd12bd2 -
Trigger Event:
workflow_dispatch
-
Statement type: