Skip to main content

OSTIR (Open Source Translation Initiation Rates)

Status Bioconda Anaconda Badge

OSTIR is a Python package for predicting the rates at which ribosomes will bind to and initiate translation from different start codons in bacterial mRNAs. It uses the ViennaRNA Package to perform the necessary free energy calculations. The code builds on the last open source version of the RBS calculator.

OSTIR includes several improvements in usability. It supports multi-FASTA input with command line parameters or CSV input that can define parameters on a per-sequence basis. Additionally, OSTIR supports multi-threaded execution, accelerating the analysis of very large sequences.

Please see the OSTIR Wiki for full documentation

Quickstart

Installation

Step by step

install with bioconda

OSTIR is a Python module and associated command line script. We recommend installing OSTIR using Bioconda on Linux or macOS. This will automatically install OSTIR and all of its dependencies, including ViennaRNA and the required Python modules.

From Bioconda (recommended; Linux, macOS):

  • Run conda install -c bioconda ostir

From Pip (for experts; Linux, macOS, Windows):

  • Download and install ViennaRNA, following the instructions here.
  • Run pip install ostir

For information on installing for development see the Wiki Documentation.

Docker

For an express run and assuming there is Docker in your system you may:

docker build . -t ostir:latest
docker run -it ostir

You should see ostir -h output

Note: By default Dockerfile is linked to Dockerfile.miniforge so that miniforge is being used to install conda. If you want any other installer (Miniconda or Anaconda), please rename/link at your best convenience.

Command Line Usage

Print OSTIR help:

ostir -h

Run OSTIR on a sequence provided at the command line and print output to the console:

ostir -i TTCTAGATGAGAATAAGGTTATGGCGAGCTCTGAAGACGTTATCAAAGAGTTCATGCGTTTCAAAGTTCGTATGGAAGGT

Run OSTIR on all sequences provided in a FASTA file and print output to a CSV file:

ostir -i input.fasta -o output.csv

More options and examples are described in the Wiki Documentation.

Python Module Usage

Run OSTIR on a sequence inside of a Python script:

from ostir import run_ostir

seq = "ACUUCUAAUUUAUUCUAUUUAUUCGCGGAUAUGCAUAGGAGUGCUUCGAUGUCAU"
results = run_ostir(seq, name="my_sequence", threads=8)
print(results)

More options and examples are described in the Wiki Documentation.

Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

ostir-1.1.3.tar.gz (165.2 kB view details)

Uploaded Source

Built Distribution

If you're not sure about the file name format, learn more about wheel file names.

OSTIR-1.1.3-py3-none-any.whl (106.2 kB view details)

Uploaded Python 3

File details

Details for the file ostir-1.1.3.tar.gz.

File metadata

  • Download URL: ostir-1.1.3.tar.gz
  • Upload date:
  • Size: 165.2 kB
  • Tags: Source
  • Uploaded using Trusted Publishing? Yes
  • Uploaded via: twine/5.1.1 CPython/3.12.7

File hashes

Hashes for ostir-1.1.3.tar.gz
Algorithm Hash digest
SHA256 6fa38a4e867c8d38aab16b59addc07ce2de03ee766ef6018c24c7a78ff163e14
MD5 f908ca01117d2b3822f57f8e36a9553d
BLAKE2b-256 abf76e62f0f43ff828da0f24696bc70b34f9ea2d6b70490d2e2a4fadaf168213

See more details on using hashes here.

Provenance

The following attestation bundles were made for ostir-1.1.3.tar.gz:

Publisher: publish-to-pypi.yml on barricklab/ostir

Attestations: Values shown here reflect the state when the release was signed and may no longer be current.

File details

Details for the file OSTIR-1.1.3-py3-none-any.whl.

File metadata

  • Download URL: OSTIR-1.1.3-py3-none-any.whl
  • Upload date:
  • Size: 106.2 kB
  • Tags: Python 3
  • Uploaded using Trusted Publishing? Yes
  • Uploaded via: twine/5.1.1 CPython/3.12.7

File hashes

Hashes for OSTIR-1.1.3-py3-none-any.whl
Algorithm Hash digest
SHA256 13f94950a2316ff83f06f0830477e2d4ebd240bc1941453716a5db8055a6ce2f
MD5 357ac1b47337ef3fb9fe92d4853de624
BLAKE2b-256 8b2a225597f7fe6ee1b446cdd6362e8b23c547c28a760e024099fefdaad52728

See more details on using hashes here.

Provenance

The following attestation bundles were made for OSTIR-1.1.3-py3-none-any.whl:

Publisher: publish-to-pypi.yml on barricklab/ostir

Attestations: Values shown here reflect the state when the release was signed and may no longer be current.

Release history Release notifications | RSS feed

This release

1.1.3 This release

2 files

1.1.2

2 files

1.1.1

1 file

1.1.0

2 files

1.0.6

2 files

1.0.5

2 files

1.0.4

2 files

1.0.3

2 files

1.0.2

2 files

1.0.1

2 files

1.0.0

2 files

0.0.1

2 files

Anthropic, PBC Visionary sponsor Bloomberg Visionary sponsor Hudson River Trading Visionary sponsor Meta Visionary sponsor NVIDIA Visionary sponsor Microsoft Sustainability sponsor Depot Continuous Integration AWS Cloud computing and Security Sponsor Datadog Monitoring Fastly CDN Google Download Analytics Sentry Error logging StatusPage Status page