Skip to main content

A package for analyzing patterns in biological data.

Project description

pattern_analysis

https://img.shields.io/pypi/v/pattern_analysis.svg https://img.shields.io/travis/ScienceComputing/pattern_analysis.svg Documentation Status Updates

A package for analyzing patterns in biological data.

Features

  • Count patterns of nucleotide interest in a genome sequence

  • Generate the complement for a genome sequence

Usage

from pattern_analysis import pattern_analysis

# Estimate the number of patterns equal to "TGATCA" in the ori sequence
ori = "ATCAATGATCAACGTAAGCTTCTAAGCATGATCAAGGTGCTCACACAGTTTATCCACAACCTGAGTGGATGACATCAAGATAGGTCGTTGTATCTCCTTCCTCTCGTACTCTCATGACCACGGAAAGATGATCAAGAGAGGATGATTTCTTGGCCATATCGCAATGAATACTTGTGACTTGTGCTTCCAATTGACATCTTCAGCGCCATATTGCGCTGGCCAAGGTGACGGAGCGGGATTACGAAAGCATGATCATGGCTGTTGTTCTGTTTATCTTGTTTTGACTGAGACTTGTTAGGATAGACGGTTTTTCATCACTGACTAGCCAAAGCCTTACTCTGCCTGACATCGACCGTAAATTGATAATGAATTTACATGCTTCCGCGACGATTTACCTCTTGATCATCGATCCGATTGAAGATCTTCAATTGTTAATTCTCTTGCCTCGACTCATAGCCATGATGAGCTCTTGATCATGTTTCCTTAACCCTCTATTTTTTACGGAAGAATGATCAAGCTGCTGCTCTTGATCATCGTTTC"

pat = "TGATCA"
res = pattern_analysis.pattern_count(ori, pat)

print("A total of {} {} are found.".format(res, pat)) # Return "A total of 8 TGATCA are found."

Credits

This package was created with Cookiecutter and the audreyr/cookiecutter-pypackage project template.

History

0.1.1 (2023-12-17)

  • Restructure the pattern analysis package using cookiecutter-pypackage.

0.1.0 (2023-12-12)

  • First release on PyPI.

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

pattern_analysis-0.1.2.tar.gz (10.4 kB view details)

Uploaded Source

Built Distribution

If you're not sure about the file name format, learn more about wheel file names.

pattern_analysis-0.1.2-py2.py3-none-any.whl (4.2 kB view details)

Uploaded Python 2Python 3

File details

Details for the file pattern_analysis-0.1.2.tar.gz.

File metadata

  • Download URL: pattern_analysis-0.1.2.tar.gz
  • Upload date:
  • Size: 10.4 kB
  • Tags: Source
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/4.0.2 CPython/3.11.6

File hashes

Hashes for pattern_analysis-0.1.2.tar.gz
Algorithm Hash digest
SHA256 41a8fbb3d4222a24d590b53c6c7997346a3d7fa431e7e1dbe8d2a9216d6c5ce7
MD5 5c330bf2ded8c69d6fb6b704f803afc3
BLAKE2b-256 1a4fc8df185244cc301c77b2fde0572aacf835c1a2492a21d5ef52b95d6ef059

See more details on using hashes here.

File details

Details for the file pattern_analysis-0.1.2-py2.py3-none-any.whl.

File metadata

File hashes

Hashes for pattern_analysis-0.1.2-py2.py3-none-any.whl
Algorithm Hash digest
SHA256 99f9a17aee72ae191cc1e9cc49624984db082c57bf0b267633122fce3b6b7f77
MD5 a52c4ad1efd3ff517855cef0f61db884
BLAKE2b-256 4b857501ba3cc69ad3f9760315f418a24d112a14484b8472fffa269c82a0664f

See more details on using hashes here.

Supported by

AWS Cloud computing and Security Sponsor Datadog Monitoring Depot Continuous Integration Fastly CDN Google Download Analytics Pingdom Monitoring Sentry Error logging StatusPage Status page