README
In-Silico PCR tool
This script takes a text file with primer sequence (one per line,optinal name in column 2, tab-seperated) and a reference FASTA file as input and identifies primer pairs which amplify a DNA sequence of length less than or equal to a user-specified maximum, at a given Tm and salt concentration. The script outputs the sequences of the primers, the portion of the primer that binds, the number of mismatches, as well as the start and end coordinates of the amplified sequence. It also outputs the Tm of the amplicons and the Tm of amplicon pairs.
Dependencies
These may be installed by running
pip install PCRinSilico
Usage
PCRinSilico [options]
--primer_seq [path to primer sequence file, one primer per line]
--ref_fasta_file [path to reference FASTA file]
Options
| Argument | Description | Default |
|---|---|---|
--annealing_temp |
Annealing temperature (in Celsius). | 60.0 |
--salt_concentration |
Salt concentration (in nM, Ignored if Q5 True). | 50 |
--max_amplicon_len |
Maximum length of PCR products in nucleotides. | 2000 |
--req_five |
Require the 5' end of the primer to bind? | True |
--out_file |
Output file name. | "in_silico_PCR" |
--Q5 |
Use Q5 approximation settings for Tm calculations? | "True" |
Example
PCRinSilico \
--primer_seq ./example/primers.txt \
--ref_fasta_file ./example/ref.fasta
in_silico_PCR.tsv
| qseq1 | qseq2_input | qstart1 | qend1 | direction1 | mismatch2 | qseq2 | qseq1_input | qstart2 | qend2 | direction2 | mismatch1 | binding_pos_diff | reference | ref_region |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| kkd_F_2 | gaacaccggcagtggttc | 1 | 18 | + | 0 | sge_R | ctgccgcagcggt | 1 | 13 | - | 0 | 300 | example | 772, 1072 |
| kkd_R | accgagctgccggacggcac | 1 | 20 | + | 0 | sge_R | ctgccgcagcggt | 1 | 13 | - | 0 | 318 | example | 772, 1090 |
in_silico_PCR_amplicon_interactions.tsv
| amplicon1_PF | amplicon1_PR | amplicon2_PF | amplicon2_PR | tm |
|---|---|---|---|---|
| kkd_F_2 | sge_R | kkd_R | sge_R | 90.22726832 |
in_silico_PCR_primer_dimears.tsv
| Sequence1 | Sequence2 | MeltingTemp |
|---|---|---|
| sge_F | sge_R | 75 |
| sge_F | kkd_F | 72 |
| sge_F | kkd_F_2 | 73 |
| sge_F | kkd_R | 79 |
| sge_R | kkd_F | 74 |
| sge_R | kkd_F_2 | 74 |
| sge_R | kkd_R | 80 |
| kkd_F | kkd_F_2 | 72 |
| kkd_F | kkd_R | 78 |
| kkd_F_2 | kkd_R | 78 |
1 maintainer
Metadata
1 maintainer
Release files for PCRinSilico 1.1.3
For a detailed explanation of source distributions (sdists) and built distributions (wheels), please see the package formats documentation.
Source distribution (sdist)
| File | Size | Uploaded | |
|---|---|---|---|
| PCRinSilico-1.1.3.tar.gz | 6.2 kB | Details |
Built distribution (wheel)
| File | Interpreter | ABI | Platform | Reset |
|---|---|---|---|---|
| PCRinSilico-1.1.3-py3-none-any.whl | Python 3 | none | any | Details |
Total release size: 12.6 kB
Release files / PCRinSilico-1.1.3.tar.gz
| Download URL | PCRinSilico-1.1.3.tar.gz |
|---|---|
| Size | 6.2 kB |
| Tags | Source |
|
SHA-256 checksum How to use checksums |
7494cd3a9bdc1515cfc83c6e85be578a670d39ba35c7bd786118607f8e103b78
|
|
BLAKE2b-256 checksum How to use checksums |
4c8adfcf1b0f4afb23d64db00f8c5277eda4c804aecbcd317bf2c6597acf7d17
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
No |
| Uploaded via |
twine/4.0.2 CPython/3.9.12
|
Release files / PCRinSilico-1.1.3-py3-none-any.whl
| Download URL | PCRinSilico-1.1.3-py3-none-any.whl |
|---|---|
| Size | 6.4 kB |
| Tags | Python 3 |
|
SHA-256 checksum How to use checksums |
8ff0b375f5d02e555ef981b8a08d91226d30aff21e0ac1e1bcb910874c11f113
|
|
BLAKE2b-256 checksum How to use checksums |
eff704395bc7102bc26a188bbf6daaebc291a66b066323d96ace8a9f3c592503
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
No |
| Uploaded via |
twine/4.0.2 CPython/3.9.12
|
