PCRinSilico 1.1.3

In silico PCR tool

README

In-Silico PCR tool

This script takes a text file with primer sequence (one per line,optinal name in column 2, tab-seperated) and a reference FASTA file as input and identifies primer pairs which amplify a DNA sequence of length less than or equal to a user-specified maximum, at a given Tm and salt concentration. The script outputs the sequences of the primers, the portion of the primer that binds, the number of mismatches, as well as the start and end coordinates of the amplified sequence. It also outputs the Tm of the amplicons and the Tm of amplicon pairs.

Dependencies

• Python 3
• Biopython
• pandas
• BLAST+

These may be installed by running

pip install PCRinSilico

Usage

PCRinSilico [options]
   --primer_seq [path to primer sequence file, one primer per line]
   --ref_fasta_file [path to reference FASTA file]

Options

Argument	Description	Default
--annealing_temp	Annealing temperature (in Celsius).	60.0
--salt_concentration	Salt concentration (in nM, Ignored if Q5 True).	50
--max_amplicon_len	Maximum length of PCR products in nucleotides.	2000
--req_five	Require the 5' end of the primer to bind?	True
--out_file	Output file name.	"in_silico_PCR"
--Q5	Use Q5 approximation settings for Tm calculations?	"True"

Example

PCRinSilico \
   --primer_seq ./example/primers.txt \
   --ref_fasta_file  ./example/ref.fasta

in_silico_PCR.tsv

qseq1	qseq2_input	qstart1	qend1	direction1	mismatch2	qseq2	qseq1_input	qstart2	qend2	direction2	mismatch1	binding_pos_diff	reference	ref_region
kkd_F_2	gaacaccggcagtggttc	1	18	+	0	sge_R	ctgccgcagcggt	1	13	-	0	300	example	772, 1072
kkd_R	accgagctgccggacggcac	1	20	+	0	sge_R	ctgccgcagcggt	1	13	-	0	318	example	772, 1090

in_silico_PCR_amplicon_interactions.tsv

amplicon1_PF	amplicon1_PR	amplicon2_PF	amplicon2_PR	tm
kkd_F_2	sge_R	kkd_R	sge_R	90.22726832

in_silico_PCR_primer_dimears.tsv

Sequence1	Sequence2	MeltingTemp
sge_F	sge_R	75
sge_F	kkd_F	72
sge_F	kkd_F_2	73
sge_F	kkd_R	79
sge_R	kkd_F	74
sge_R	kkd_F_2	74
sge_R	kkd_R	80
kkd_F	kkd_F_2	72
kkd_F	kkd_R	78
kkd_F_2	kkd_R	78