pepkio-codon-host-fit-checker

A Python client and CLI for evaluating sequence-level host compatibility, Codon Adaptation Index (CAI), rare codon bottlenecks, and GC composition profiles across major expression hosts.

What It Does

pepkio-codon-host-fit-checker provides Python bindings and a command-line interface to evaluate host expression suitability for heterologous genes. It quantifies the Codon Adaptation Index (CAI), pinpoints local rare codon clusters ($w_i < 0.15$), profiles positional GC distributions ($GC_1, GC_2, GC_3$), and flags translational obstacles across bacterial (E. coli, B. subtilis), yeast (S. cerevisiae, P. pastoris), insect (Sf9), and mammalian (CHO, HEK293) expression systems.

Features

• Multi-Host Compatibility Profiling: Evaluates nucleotide sequences against reference codon usage tables for E. coli (K-12 & BL21(DE3)), S. cerevisiae, P. pastoris, CHO, HEK293, Sf9, and B. subtilis.
• Codon Adaptation Index (CAI): Calculates geometric mean CAI scores relative to host-specific high-expression reference gene sets.
• Rare Codon & Bottleneck Mapping: Highlights codons with host frequency $< 15%$ and flags tandem rare codon clusters that trigger ribosomal pausing or translation stalling.
• Positional GC & Regional Composition: Computes overall GC content alongside position-specific ($GC_1, GC_2, GC_3$) and sliding-window regional GC metrics to detect destabilizing composition spikes.
• Translational Signal Screening: Detects internal prokaryotic ribosome binding sites (Shine-Dalgarno-like sequences), eukaryotic cryptic splice donor/acceptor sites, and out-of-frame stop codons.
• Side-by-Side Comparison Matrix: Compares candidate gene compatibility across multiple expression hosts simultaneously in a unified matrix format.
• Python API & CLI: Offers synchronous and asynchronous execution in Python alongside a CLI producing structured JSON output for pipeline integration.

Installation

Install the package via pip:

pip install pepkio-codon-host-fit-checker

Quick Example

from pepkio_codon_host_fit_checker import PepkioClient

with PepkioClient() as client:
    # Evaluate sequence compatibility across bacterial and mammalian expression hosts
    result = client.run({
        "tab": "matrix",
        "sequence": "ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAG",
        "host_ids": ["e_coli_k12", "s_cerevisiae", "cho_cell"]
    })

    print("Status:", result.status)
    print("Host Compatibility Results:", result.result)

Typical Use Cases

• Expression Host Organism Selection: Compare codon adaptation metrics across bacterial (E. coli), yeast (P. pastoris), and mammalian (CHO) systems prior to cloning to identify optimal host compatibility.
• Gene Synthesis Pre-Flight Auditing: Audit codon-optimized constructs from commercial synthesis vendors to verify the elimination of rare codon bottlenecks without introducing secondary structures or cryptic splice sites.
• Troubleshooting Expression Yield Drops: Diagnose protein yield drops or truncated expression products by mapping host-specific rare codon clusters in heterologous genes.
• Dual-Host Vector Optimization: Assess sequence suitability for shuttle vector constructs intended for initial expansion in E. coli followed by functional expression in eukaryotic hosts.
• Metabolic Pathway & Operon Balancing: Profile translational efficiency across multi-gene synthetic operons to prevent host cell metabolic strain and resource competition.

Scientific Background

Heterologous protein expression efficiency is closely tied to how well a target sequence matches the host organism's tRNA pool and codon usage preferences. The Codon Adaptation Index (CAI) quantifies this bias by measuring the geometric mean of relative adaptiveness values ($w_i$) for all codons relative to a reference set of highly expressed genes. However, global CAI scores alone can mask localized rare codon clusters (codons with relative adaptiveness $w_i < 0.15$ or host frequency $< 15%$) that induce ribosomal stalling, co-translational misfolding, or premature termination. Additionally, extreme regional GC composition imbalances ($GC_1, GC_2, GC_3$) and unwanted sequence signals like internal Shine-Dalgarno motifs or cryptic splice sites can severely impair mRNA stability and translation yield.

Web Application

For researchers who prefer a graphical interface, an interactive web version is available.

Web Application: https://www.pepkio.com/tools/codon-host-fit-checker

The web application provides visual codon frequency heatmaps, interactive host comparison matrices, downloadable worksheets, and shareable permalinks.

Documentation and Resources

GitHub Repository: https://github.com/pepkio/pepkio-codon-host-fit-checker

Web Application: https://www.pepkio.com/tools/codon-host-fit-checker

Source and issue tracker: https://github.com/pepkio/pepkio-codon-host-fit-checker

About Pepkio

Pepkio (https://www.pepkio.com/) develops software tools and bioinformatics solutions for life science researchers, including laboratory calculators and analysis services (https://www.pepkio.com/cro).

Keywords

• codon host fit checker
• codon adaptation index
• CAI calculator
• rare codon finder
• codon usage bias
• tRNA adaptation index
• GC content analyzer
• position specific GC
• GC1 GC2 GC3
• heterologous expression
• recombinant protein expression
• gene synthesis optimization
• host expression compatibility
• E. coli expression checker
• yeast codon adaptation
• CHO host fitness
• Pichia pastoris expression
• HEK293 codon usage
• Sf9 insect cell expression
• Bacillus subtilis expression
• Shine Dalgarno motif finder
• cryptic splice site detector
• ribosomal pausing predictor
• synthetic biology tools
• bioinformatics python client
• evaluate codon adaptation index in python
• host specific rare codon bottleneck detection
• multi host codon compatibility matrix comparison
• optimize nucleotide sequence for heterologous protein yield
• detect translational obstacles in synthetic constructs
• pre flight audit for gene synthesis orders
• dual host shuttle vector sequence analysis
• positional GC composition profiling for recombinant genes
• troubleshoot protein expression yield drops in e coli
• compare mammalian yeast and bacterial expression hosts
• automated codon host fit checker python api
• programmatic codon bias calculation command line tool
• co translational protein folding rare codon analysis