poola_be
Python package for base editor screens
Install
pip install poola_be
How to use
To demonstrate the use of these functions, we will first design a base editor tiling library with guides tiling the transcript ENST00000380152 of BRCA2. These guides are annotated with predicted edits using the C>T base editor in the window of nucleotide 4-8.
from poola_be import core as pool_be
import pandas as pd
design_df = pd.read_csv('sample_input/crisprbe-guides.txt', sep='\t')
design_df.head()
.dataframe tbody tr th {
vertical-align: top;
}
.dataframe thead th {
text-align: right;
}
</style>
| Input | CRISPR Enzyme | Edit Type | Edit Window | Target Assembly | Target Genome Sequence | Target Gene ID | Target Gene Symbol | Target Gene Strand | Target Transcript ID | ... | PAM Sequence | sgRNA Target Sequence Start Pos. (global) | sgRNA Orientation | Nucleotide Edits (global) | Guide Edits | Nucleotide Edits | Amino Acid Edits | Mutation Category | Constraint Violations | Note | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 0 | ENST00000380152 | SpyoCas9 | C-T | 4..8 | GRCh38 (9606) | NC_000013.11 | ENSG00000139618 | BRCA2 | + | ENST00000380152.8 | ... | TGG | 32316449 | sense | NaN | NaN | NaN | NaN | NaN | NaN | NaN |
| 1 | ENST00000380152 | SpyoCas9 | C-T | 4..8 | GRCh38 (9606) | NC_000013.11 | ENSG00000139618 | BRCA2 | + | ENST00000380152.8 | ... | AGG | 32316462 | sense | 32316465C>T | C_4 | 5C>T | Pro2Leu | Missense | NaN | NaN |
| 2 | ENST00000380152 | SpyoCas9 | C-T | 4..8 | GRCh38 (9606) | NC_000013.11 | ENSG00000139618 | BRCA2 | + | ENST00000380152.8 | ... | AGG | 32316467 | antisense | 32316479G>A;32316481G>A, 32316483G>A | C_8_6, C_4 | 19G>A;21G>A, 23G>A | Glu7Lys, Arg8Lys | Missense, Missense | NaN | NaN |
| 3 | ENST00000380152 | SpyoCas9 | C-T | 4..8 | GRCh38 (9606) | NC_000013.11 | ENSG00000139618 | BRCA2 | + | ENST00000380152.8 | ... | TGG | 32316477 | antisense | NaN | NaN | NaN | NaN | NaN | NaN | NaN |
| 4 | ENST00000380152 | SpyoCas9 | C-T | 4..8 | GRCh38 (9606) | NC_000013.11 | ENSG00000139618 | BRCA2 | + | ENST00000380152.8 | ... | TGG | 32316488 | antisense | NaN | NaN | NaN | NaN | NaN | NaN | NaN |
5 rows × 23 columns
Assign severe mutation bin
As noted in the "Mutation Category" column, each guide is predicted to make more one or more types of mutations if Cs are present in the editing window. We can then annotate each guide with the most severe mutation bin in the order Nonsense > Splice site > Missense > Intron > Silent > UTR > no edit.
design_df['Mutation Bin'] = design_df['Mutation Category'].apply(pool_be.get_most_severe_mutation_type)
design_df[['sgRNA Target Sequence','Mutation Category','Mutation Bin']].head()
.dataframe tbody tr th {
vertical-align: top;
}
.dataframe thead th {
text-align: right;
}
</style>
| sgRNA Target Sequence | Mutation Category | Mutation Bin | |
|---|---|---|---|
| 0 | TCGTAGGTAAAAATGCCTAT | NaN | No edits |
| 1 | TGCCTATTGGATCCAAAGAG | Missense | Missense |
| 2 | GGCCTCTCTTTGGATCCAAT | Missense, Missense | Missense |
| 3 | AAAAAATGTTGGCCTCTCTT | NaN | No edits |
| 4 | TTAAAAATTTCAAAAAATGT | NaN | No edits |
Calculate median residue
We can then get the median residue of the predicted edits.
design_df['Median Residue'] = design_df.apply(lambda x: pool_be.get_median_residues(x['Mutation Bin'], x['Amino Acid Edits']), axis=1)
design_df[['sgRNA Target Sequence','Amino Acid Edits','Mutation Category','Mutation Bin','Median Residue']].head(15)
.dataframe tbody tr th {
vertical-align: top;
}
.dataframe thead th {
text-align: right;
}
</style>
| sgRNA Target Sequence | Amino Acid Edits | Mutation Category | Mutation Bin | Median Residue | |
|---|---|---|---|---|---|
| 0 | TCGTAGGTAAAAATGCCTAT | NaN | NaN | No edits | NaN |
| 1 | TGCCTATTGGATCCAAAGAG | Pro2Leu | Missense | Missense | 2.0 |
| 2 | GGCCTCTCTTTGGATCCAAT | Glu7Lys, Arg8Lys | Missense, Missense | Missense | 7.5 |
| 3 | AAAAAATGTTGGCCTCTCTT | NaN | NaN | No edits | NaN |
| 4 | TTAAAAATTTCAAAAAATGT | NaN | NaN | No edits | NaN |
| 5 | AAGACACGCTGCAACAAAGC | Thr17Ile, Arg18Cys | Missense, Missense | Missense | 17.5 |
| 6 | TTTTTTTTTTAAATAGATTT | NaN | NaN | No edits | NaN |
| 7 | TAGGACCAATAAGTCTTAAT | Pro26Leu | Missense | Missense | 26.0 |
| 8 | TCAAACCAATTAAGACTTAT | Trp31Ter | Nonsense | Nonsense | 31.0 |
| 9 | GCAGGTTCAGAATTATAGGG | Glu45Lys | Missense | Missense | 45.0 |
| 10 | TCTGCAGGTTCAGAATTATA | Ala47Thr | Missense | Missense | 47.0 |
| 11 | TTCTGCAGGTTCAGAATTAT | Ala47Thr | Missense | Missense | 47.0 |
| 12 | TTATGTTCAGATTCTTCTGC | Glu51Lys | Missense | Missense | 51.0 |
| 13 | TGTGGAGTTTTAAATAGGTT | NaN | NaN | No edits | NaN |
| 14 | ACCTATTTAAAACTCCACAA | NaN | NaN | No edits | NaN |
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
Built Distribution
Filter files by name, interpreter, ABI, and platform.
If you're not sure about the file name format, learn more about wheel file names.
Copy a direct link to the current filters
File details
Details for the file poola_be-0.0.1.tar.gz.
File metadata
- Download URL: poola_be-0.0.1.tar.gz
- Upload date:
- Size: 12.9 kB
- Tags: Source
- Uploaded using Trusted Publishing? No
- Uploaded via:
twine/3.4.1 importlib_metadata/3.10.0 pkginfo/1.5.0.1 requests/2.22.0 requests-toolbelt/0.9.1 tqdm/4.42.1 CPython/3.8.3
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
e2f186a1e394289707ef819c1ada106a0e6d43ebc6e58428a259d138df628d57
|
|
| MD5 |
a2d83d7f04a38f8d47f34961ae37a2ee
|
|
| BLAKE2b-256 |
384e794896557311f205a7ef1047e658bb29ac84e9b5863cab5b0246d416c576
|
File details
Details for the file poola_be-0.0.1-py3-none-any.whl.
File metadata
- Download URL: poola_be-0.0.1-py3-none-any.whl
- Upload date:
- Size: 8.8 kB
- Tags: Python 3
- Uploaded using Trusted Publishing? No
- Uploaded via:
twine/3.4.1 importlib_metadata/3.10.0 pkginfo/1.5.0.1 requests/2.22.0 requests-toolbelt/0.9.1 tqdm/4.42.1 CPython/3.8.3
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
d4e1a7ec31b15046e0ea9049feea7f2f7d405c23b7685c8e624690d28579ae11
|
|
| MD5 |
bca2285c78cc41b601ef1a6cc66287aa
|
|
| BLAKE2b-256 |
593c68afa6d60e3c5983eed57bd5f503d031322e041b2488577d3c6cb1ae28eb
|